Em formação

Com que idade o crânio do rato para de crescer?

Com que idade o crânio do rato para de crescer?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Salvo disposição em contrário, a pesquisa neurocientífica em camundongos é feita com animais de 7 semanas de idade. Existe uma espécie de mantra que, nessa idade, seus crânios param de crescer.

No entanto, recentemente, notei uma diferença bastante robusta em como devo colocar ratos de ~ 4 meses em um scanner em comparação com os de 7 semanas. Tenho certeza de que isso se deve ao tamanho do crânio, já que estou fixando todos os meus animais em relação ao canal auditivo e não deve haver acúmulo de gordura / cabelo no ouvido interno. Além disso, se houvesse, tenho certeza de que sentiria.

Isso me fez tentar pesquisar a fonte da recomendação de 7 semanas, mas até agora não encontrei nada. Você sabe se é correto que o crânio do rato "para de crescer" às 7 semanas de idade e, em caso afirmativo, que estudos apóiam essa observação?


Isso não responde totalmente à pergunta, mas para as suturas do crânio de camundongos que se fundem, a fusão está completa por volta dos 45 dias de idade, de acordo com Estudos em biologia de sutura craniana: IV. Seqüência temporal da fusão da sutura craniana frontal posterior no mouse. Isso sugere que a maior parte da expansão craniana está mais ou menos completa por volta das 6 semanas de idade. Acho que ainda existe o potencial de remodelação do crânio, especialmente da espessura do osso e assim por diante, mas como o seu interesse é no tamanho interno da cavidade, isso pode ajudar a abordá-lo.


Aparentemente, há um artigo muito bom com algumas figuras muito informativas sobre a base do crânio e o desenvolvimento craniofacial em camundongos. Eles medem a distância entre os principais marcos do crânio durante um período de 112 dias.

O artigo não busca especificamente por marcos que permitam um bom posicionamento do cérebro em relação ao canal auditivo, mas a partir de seus dados sobre o comprimento da Base do Crânio, pode-se concluir que:

  • A posição do cérebro em relação ao canal auditivo é altamente variável durante os primeiros 28 dias pós-natal.
  • A posição do cérebro em relação ao canal auditivo, junto com a maioria das medidas pertencentes ao neurocrânio, tornam-se mais estáveis ​​após cerca de 56 dias de idade.
  • Existem mudanças pequenas, mas significativas no neurocrânio entre 56 e 112 dias de idade. A posição do cérebro em relação ao canal auditivo pode, por exemplo, tornar-se cerca de 0,5 mm mais rostral entre 56 e 112 dias de idade.

Minha observação indica a mesma tendência, embora eu diria que a mudança de posição foi maior (talvez 2 mm) - mas como eles não escolheram o canal auditivo adequado como um ponto de referência, é difícil comparar.


Com que idade o crânio do rato para de crescer? - Biologia

Como faço para lidar com ratos?
A maioria das linhagens de camundongos é bastante dócil e não morderá a menos que seja provocada. Se os ratos ficarem chateados, faça outra coisa e volte para eles depois que se acalmarem.

Transferência de ratos de gaiola para gaiola. Delicadamente, pegue o mouse pela cauda com a mão enluvada. Segurar o mouse pela base da cauda lhe dará maior controle. Os ratos sem cauda podem ser agarrados pela nuca. Relaxe e manuseie os camundongos com cuidado. Na maioria das circunstâncias, se você estiver relaxado, se o mouse tentar mordê-lo, será uma mordidela exploratória que não fará mal. Algumas cepas, particularmente cepas de origem selvagem, são muito ativas e podem representar problemas de manuseio. Uma pinça longa (Fisher 10-316C) é útil com essas cepas. O fórceps não deve ser usado a menos que seja necessário para a proteção do manipulador.

Verificando plugues, inspecionando ratos. Para verificar os plugues e algumas outras observações, é necessário um pouco mais de controle do mouse. Transfira o mouse para o topo da gaiola com as barras da gaiola correndo da esquerda para a direita. Segure o mouse pela base da cauda entre o polegar e o indicador e coloque o resto dos dedos da mão que segura no sacro e na região lombar do mouse. Quando você segura o mouse, ele se afasta de você com as patas dianteiras na barra da gaiola, permitindo que você inspecione suas regiões inferiores.

Manipulação de camundongos para marcação, injeções e gavagem. O controle completo do mouse é necessário para marcação, injeções e gavagem. As instruções a seguir resultarão em um mouse imobilizado em sua mão esquerda, com a direita livre. Posicione o mouse no topo das barras da gaiola, com as barras correndo da esquerda para a direita. Segure a cauda com a mão direita e, em seguida, esfregue o mouse com a mão esquerda. Scruffing o mouse corretamente é a chave para o sucesso. Você deseja imobilizar a cabeça do rato e, para isso, toda a pele solta ao redor da nuca deve ser raspada. Para obter toda essa pele em suas mãos, comece o movimento de esfregar na parte inferior dos ombros do mouse, com o polegar de um lado e o indicador do outro. A pele na parte de trás do mouse pode ficar presa entre os dedos restantes e a palma da mão. Para gavagem e injeção, o corpo do mouse também precisa ser imobilizado: estique o corpo do mouse puxando suavemente a cauda com a mão direita e enganchar o dedo mínimo da mão esquerda sobre a cauda. Uma descrição mais extensa e detalhada de como realizar gavagem é fornecida aqui.

Se você não for obrigado a trabalhar com os ratos em uma determinada hora do dia, poderá achar mais fácil trabalhar com os ratos pela manhã ou no início da tarde. Os camundongos ficam mais ativos logo antes de as luzes se apagarem e geralmente são mais difíceis de lidar no final do dia.

Como faço para diferenciar homens de mulheres?
A distância entre a genitália externa e o ânus é maior nos homens do que nas mulheres em todos os estágios pós-natais. Após cerca de duas semanas de idade, os mamilos das mulheres são normalmente visíveis, enquanto os dos homens não são. Em adultos, o escroto do homem (e os testículos, se forem evertidos) é um marcador óbvio. Para pré-adultos, oriente a gaiola de forma que as barras corram da esquerda para a direita e coloque o mouse na grade da gaiola. Segure a cauda do mouse entre o polegar e o indicador, coloque os outros dedos na parte de trás do mouse e dobre a extremidade inferior do mouse na sua direção. O mouse tentará se afastar de você usando as barras da gaiola. É mais fácil fazer sexo com camundongos recém-nascidos se a região genital do camundongo estiver totalmente estendida: pegue os camundongos e dobre suavemente a parte inferior das costas para esticar a região genital. Em cepas pigmentadas, camundongos recém-nascidos machos têm uma mancha de pigmento sobre o escroto. Com cerca de duas semanas de idade, os mamilos das fêmeas são mais proeminentes do que os dos machos. Embriões e fetos podem ser tipados por PCR com os iniciadores SMCX-1 5'CCGCTGCCAAATTCTTTGG3 'e SMC4-1 5'TGAAGCTTTTGGCTTTGAG3'. As fêmeas dão uma única banda e os machos dão duas bandas por causa de uma diferença de íntron entre os genes X e Y (Agulnik et al. 1997 Mamm. Genome 8, 134-138.) Alternativamente, iniciadores Jarid 1c F CTGAAGCTTTTGGCTTTGAG & Jarid 1 c R CCACTGCCAAATTCTTTGG amplificar uma banda de 331 bp em mulheres, mas duas bandas de 302 e 331 bp em homens: Clapcote SJ e Roder JC. Biotechniques 2005 38 (5): 702. Ensaio de PCR simplex para determinação do sexo em camundongos. PMID: 15945368.

Como faço para acasalar ratos?
Se você não tem pressa em produzir muitos descendentes, alimente um camundongo macho com uma ou duas fêmeas. Os ratos podem ser deixados juntos até que os filhotes estejam prontos para serem desmamados, se a gaiola não ficar muito cheia. Se você precisa de ratos predominantemente de um sexo, você pode remover o sexo indesejado alguns dias após o nascimento (não perturbe as mães durante as primeiras 24 horas após o nascimento). Os filhotes restantes crescerão mais rápido. No entanto, você deve estar ciente de que as fêmeas são melhores mães se tiverem pelo menos 3 filhotes para cuidar, então não descarte muito severamente. Se precisar expandir uma linhagem rapidamente, você pode acasalar as fêmeas em estro com os machos todos os dias e verificar os plugues na manhã seguinte. As fêmeas domésticas com plugues semelhantes namoram até o desmame dos filhotes. Para muitas cepas, duas fêmeas grávidas e suas ninhadas podem ser alojadas juntas até o desmame, embora você possa descobrir que cepas particularmente fecundas como CD1 exigem que a gaiola seja dividida para evitar superlotação. As diretrizes do IACUC para camundongos com ninhadas limitam o número de camundongos a 2 adultos e não mais que 20 filhotes.

Quanto tempo dura a gestação?
A gestação é de 18 a 20 dias, dependendo da cepa.

Como posso evitar que as mães canibalizem suas ninhadas?
Os camundongos são sociáveis ​​e cuidam melhor de seus filhotes quando eles estão na casa de amigos. Alojar fêmeas continuamente com o pai, ou alojar fêmeas grávidas juntas ou alojar uma fêmea grávida com uma não grávida. No entanto, não coloque ratos em uma gaiola apenas alguns dias antes do nascimento, pois isso os perturbará. As mães pela primeira vez e as mulheres muito jovens têm menos probabilidade de criar uma ninhada com sucesso do que as mães experientes e as mulheres mais maduras. As mães e suas ninhadas não devem ser incomodadas no primeiro dia após o nascimento. No segundo dia, as mães devem ter adquirido um comportamento materno completo e tolerarão melhor as interrupções. Condições ambientais adversas, como ruídos altos repentinos e ventilação inadequada, também podem ter um efeito prejudicial. Algumas cepas são mais maternas do que outras (veja a lista de características de cepas de Jax). Em situações difíceis, você pode promover os filhotes para uma linhagem mais maternal ou co-alojar uma camundonga grávida de uma linhagem materna no mesmo ou mais avançado estágio de gravidez (com uma cor de pelo diferente) junto com sua mãe problemática. Você pode manter uma ou várias gaiolas de pares de acasalamento não consanguíneos (por exemplo, camundongos CD1 de Charles River) à disposição para criar filhotes. Uma descrição detalhada de como promover ratos fornecida pelo Laboratório Jackson está disponível aqui. Além disso, consulte a seção abaixo sobre como aumentar o desempenho reprodutivo.

Quando os ratos devem ser desmamados?
Os camundongos devem ser desmamados 3 a 4 semanas após o nascimento. Os filhotes devem ser desmamados se a mesma mãe der à luz uma segunda ninhada. Os filhotes devem ser robustos, ativos, ter olhos, dentes e pêlo de adulto abertos, em vez do pêlo mais ralo dos bebês. Eles precisam ser capazes de pular até o topo da gaiola para se alimentar e beber. Se eles forem muito imaturos, deixe-os ficar mais tempo com a mãe. Em muitas linhagens, os filhotes prontos para desmamar irão "pipocar" quando a tampa da gaiola for aberta. Se você não tiver certeza da capacidade deles de se curar por conta própria, deixe um pouco de comida amaciada com água no fundo da gaiola para ajudá-los nos primeiros dois dias.

Quando os ratos se tornam sexualmente maduros?
Os ratos fêmeas tornam-se sexualmente maduros 6 semanas após o nascimento e os machos 8 semanas.

Quais são os métodos aceitáveis ​​de eutanásia?
Ratos são narcotizados por CO2 inalação e, em seguida, sacrificados por luxação cervical. Embora CO2 sozinho pode sacrificar os animais, deve-se verificar se os animais morreram (ver as diretrizes do NIH sobre o uso de CO2 sozinho), portanto, o deslocamento cervical é recomendado após o uso de CO2. CO2 deve ser entregue de um tanque, não de gelo seco. O ARC fornece tanques e câmaras. Deixe o gás fluir por 1 minuto para encher a câmara e deixe a câmara fechada por 5 minutos. A narcotização dos ratos é rápida, por isso não deixe a câmara sem vigilância. A morte deve ser garantida por deslocamento cervical. Nas diferentes instalações do CWRU, os ratos podem ser deixados nos racks em uma sala designada para serem sacrificados pela equipe do ARC. Os ratos não devem estar superlotados e devem ter comida e água suficientes para durar até o horário de trabalho do próximo dia de trabalho. Se os filhotes não desmamados forem deixados sem a mãe, o ARC deve ser notificado imediatamente para que a eutanásia seja realizada imediatamente.

CO2 pois a eutanásia é barata, conveniente, eficaz e apresenta poucos riscos para a equipe e investigadores, mas a humanidade de seu uso é cada vez mais debatida. Um método alternativo de eutanásia é anestesiar os camundongos com isoflurano antes do deslocamento cervical. Em uma coifa química (ou seja, uma coifa à prova de explosão ventilada para fora), coloque uma tampa cheia de isoflurano nos tecidos no fundo de uma pequena câmara (uma caixa de pipeta de plástico vazia para eutanásia em camundongos), coloque o mouse dentro e feche a câmara. Quando o mouse estiver imóvel, abra a câmara e faça o deslocamento cervical. Esteja ciente de que o isoflurano é um perigo para a saúde e a exposição ao pessoal deve ser evitada confinando o uso a capelas de exaustão química e aparelhos de anestesia e por armazenamento adequado.

Os camundongos podem ser sacrificados por deslocamento cervical sem anestesia por indivíduos experientes e competentes, se cientificamente justificado. O IACUC pode exigir demonstração de proficiência em luxação cervical. O deslocamento cervical é realizado pegando o mouse pela base da cauda. O rato pode agarrar as barras de uma gaiola orientada transversalmente e, ao mesmo tempo que puxa suavemente para trás pela cauda, ​​a base do crânio é segurada com firmeza entre o polegar e o indicador. Para garantir a eutanásia humanitária, a luxação cervical deve ser aprendida sob a supervisão de um indivíduo qualificado.

Quais são os métodos aceitáveis ​​de eutanásia para ratos fetais e recém-nascidos?
Camundongos recém-nascidos podem ser narcotizados em um pequeno saco plástico com CO2 a partir de um cilindro de gás, o saco é selado e, em seguida, os camundongos são sacrificados e colocados em um freezer. Os regulamentos completos do CWRU IACUC e recomendações sobre métodos aceitáveis ​​de eutanásia de ratos fetais (mais de 14 dias de gestação), ratos recém-nascidos e ratos jovens estão disponíveis aqui.

Quais são as formas eficazes aceitáveis ​​de marcar ratos?
O IACUC regula a marcação de camundongos. A perfuração da orelha (perfuradores de ouvido: Fisher 01-337B ou Kent Scientific INS301202) pode ser realizada sem anestesia. As orelhas externas são grandes o suficiente para serem perfuradas após 2 semanas de idade. No entanto, os furos nas orelhas podem se tornar difíceis de ler após várias semanas devido à cicatrização. Para uma marcação mais permanente, é aceitável remover a última articulação do dedo do pé sem anestesia durante a primeira semana após o nascimento. Apenas um dedo do pé pode ser preso por membro. A anestesia deve ser usada para tosquiar os dedos dos pés de camundongos com mais de uma semana. Uma justificativa científica deve ser fornecida para o uso de tosquia em vez de outros métodos de identificação. A política CWRU IACUC completa sobre corte de dedos está aqui. A tatuagem é uma alternativa aceitável, embora seja menos comumente usada. A tinta nanquim em uma seringa de 1 ml com uma agulha de calibre 30 pode ser usada para marcar as patas em diferentes combinações. Como alternativa, tintas de tatuagem comerciais e dispositivos de tatuagem estão disponíveis (http://www.ketchum.ca). Em alguns casos, os genótipos são necessários no nascimento: tatuar com tinta nanquim de patas recém-nascidas com corte de cauda funciona bem na prática. Ratos, incluindo recém-nascidos, podem ser marcados por algumas horas com um marcador indelével & # 150 & # 150, entretanto, a tinta é rapidamente removida pelas mães ou por escovagem, tornando necessário o remarcação. Chips de transponder de ID implantados são uma alternativa, se o custo e a mão de obra não forem obstáculos.


Como os ratos são genotipados?
Uma maneira eficiente de gerenciar seus camundongos é desmamar, dar um soco na orelha e genotipar ao mesmo tempo. A genotipagem por PCR é a mais eficiente. Idealmente, os primers de PCR são específicos para a mutação, ao invés de um conjunto genérico como primers para neo R ou lacZ. Informações abrangentes sobre o desenvolvimento e validação de ensaios para genotipagem de camundongos estão disponíveis aqui. Um protocolo simples e confiável para PCR de perfurações de ouvido é fornecido aqui. Alternativamente, Southern blots podem ser realizados em DNA de dedo do pé preparado pelo método descrito aqui.

Como os homens e mulheres são alojados? Os machos não lutam?
As fêmeas podem ser alojadas cinco em uma gaiola e podem ser misturadas com fêmeas desconhecidas sem problemas. Atenção especial deve ser dada ao alojamento dos machos por causa de sua propensão para a luta. Os machos geralmente não lutarão se forem alojados juntos desde antes da maturidade sexual até a velhice. Após a maturidade sexual, os machos lutarão quando apresentados a um novo macho. Por exemplo, os machos que foram alojados sozinhos lutarão com qualquer macho apresentado. Portanto, machos da mesma ninhada devem ser alojados juntos desde tenra idade para conservar espaço. Os machos usados ​​como machos reprodutores são alojados um por gaiola e nunca são colocados em uma gaiola com outros machos. Os sinais de luta entre homens se manifestam como feridas de mordida e podem resultar em morte. As fêmeas alojadas juntas às vezes não se dão bem e isso pode se manifestar como bigodes aparados até a raiz, outras áreas nitidamente demarcadas de queda de cabelo sem lesões na pele (barbearia) ou mordidas nas costas e quartos traseiros. Na maioria das vezes, esse comportamento pode ser eliminado abrigando as fêmeas em questão em uma densidade mais baixa ou removendo a fêmea dominante (aquela que ainda tem bigodes e não tem mordidas). A barbearia leve a moderada pode não exigir separação, mas merece uma observação mais cuidadosa caso a agressão aumente.

O que é um plugue?
Os plugues são úteis para obter acasalamentos temporizados. Um tampão é o sêmen endurecido que bloqueia a vagina e permanece no local por cerca de 12 horas após o acasalamento. Os tampões são detectados por inspeção visual ou por sondagem suave com um palito de dente estéril ou sonda romba (Fisher seeker 08-995) em uma mulher imobilizada conforme descrito acima. Presume-se que o acasalamento ocorra no ponto médio do ciclo escuro (meia-noite em um ciclo on / off de 12 horas começando às 6) e, portanto, o meio-dia do dia seguinte é 0,5 dias de gestação. Para uma descrição completa dos estágios de embriogênese de camundongo e desenvolvimento fetal, ver Hogan, B. L. M., Beddington, R., Costantini, F. e Lacy, E. (1994). & quotManipulando o embrião do mouse. A Laboratory Manual. & Quot Cold Spring Harbor Press.

Como posso saber se um camundongo está em cio?
Camundongos fêmeas em estro serão receptivos ao acasalamento. Ao escolher fêmeas no estro, você pode maximizar a procriação de seus camundongos ou obter várias fêmeas acasaladas ao mesmo tempo. Você deve esperar que dois terços a três quartos dos ratos em estro acasalem, em média. As fêmeas em estro apresentam inchaço do lábio da vulva próximo ao ânus. Pegue a fêmea pela cauda no terço proximal e, com o polegar e o dedo indicador segurando a cauda, ​​deixe o mouse segurar a barra da gaiola com as patas dianteiras e pressione suavemente com os outros dedos na parte inferior das costas e sacro para inclinar os órgãos genitais. região anal para cima (uma posição lordótica). No estro, a vulva fica inchada, mas a vagina não fica aberta.

O ciclo estral é de 4 a 6 dias, então cerca de 1 em 5 fêmeas, em média, deve estar em estro a qualquer momento se as fêmeas estiverem ciclando aleatoriamente. No entanto, as fêmeas alojadas continuamente juntas podem ciclar juntas ou podem sair do ciclo estral. Mulheres jovens (6 a 8 semanas) têm menos probabilidade de parar de andar de bicicleta. A exposição a feromônios masculinos reiniciará o ciclo, assim como a mudança de grupos sociais entre as mulheres. A transferência da cama da gaiola de um homem sexualmente maduro pode ser usada para estimular o ciclismo.

Meus ratos não estão reproduzindo. O que pode ser feito para promover a reprodução?
Os ratos reproduzem-se melhor se tiverem menos de oito meses, por isso, mantenha um registo da idade dos seus ratos. As cepas com fertilidade reduzida se reproduzem melhor quando são jovens, mas mesmo as cepas mais robustas não se reproduzem bem depois de um ano de idade. Saiba o que esperar de sua cepa: a lista de características da cepa de Jax é útil a esse respeito. A quantidade de gordura na dieta pode ter um efeito significativo na fecundidade feminina (mais gordura, mais fecundação), mas o aumento da gordura pode ter um efeito prejudicial no desempenho do reprodutor. O ARC pode fornecer aos seus camundongos uma ração alternativa com maior teor de gordura (a dieta padrão é Purina 5010, uma ração com baixo teor de gordura Purina 5021 é uma ração com alto teor de gordura). Ruídos repentinos podem ter um efeito prejudicial na reprodução, assim como a baixa qualidade do ar. Privacidade fornecida por "love shacks" (KLASS 4960 Almaden Expressway, Suite 233, San Jose, CA 95118, EUA. Tel: (408) 266-1235 caixas de aninhamento de camundongos MB-01) ou nestlets (VWR 10279-140) pode ajudar tímidos Deformação. O ciclo claro-escuro tem efeitos significativos na reprodução do mouse. Certifique-se de que seus ratos estão no ciclo apropriado (12 horas de luz, 12 horas de escuridão). Em alguns casos, estender o período de luz (14 horas de luz e 10 horas de escuridão) pode melhorar o sucesso reprodutivo.

Meu mouse fechou ou aumentou os olhos, tumores, alopecia ou convulsões: o que há de errado?
Os ratos podem sofrer de várias doenças. O espectro de doenças depende da cepa, das condições de alojamento e de uma ampla variedade de outras condições, mas a pequena lista acima fornece muitas das doenças comuns em camundongos. No entanto, discuta a saúde de seus ratos com o veterinário com frequência. O cartão ARC Morbidity and Mortality Report (MMR) pode ser usado pela equipe de pesquisa para rotular a gaiola de um camundongo doente para obter o exame do animal por um veterinário ARC. Coloque a cópia impressa no verso com o logotipo ARC na gaiola do animal e entregue as duas primeiras cópias no escritório do técnico veterinário, EB12A.

Recursos úteis sobre a saúde do mouse incluem

O Jackson Laboratory & # 146s lista de cepas consanguíneas de camundongos, o que dá a suscetibilidade de diferentes cepas de camundongos a doenças.

Diretrizes para avaliar a condição e a saúde de camundongos, um arquivo pdf de um artigo do Laboratório Animal.

O site de Patologia Comparada na UC Davis

Site do Comitê Americano de Doenças de Animais de Laboratório (ACLAD).

Devo me preocupar com o histórico genético de meus camundongos mutantes?
Os antecedentes genéticos podem ter um efeito significativo no fenótipo mutante. Para muitos mutantes, você desejará ter sua mutação em uma cepa consanguínea comum bem caracterizada, robusta, como C57Bl / 6. Uma mutação normalmente é cruzada no fundo C57Bl / 6 por 10 gerações, momento em que é considerada congênica, uma vez que se espera que o genoma seja 99,8% C57Bl / 6. (Informações detalhadas sobre o conteúdo esperado do genoma em cada geração de retrocruzamento estão disponíveis no livro de Lee Silver, Mouse Genetics, disponível online no Laboratório Jackson). A mutação pode continuar a ser cruzada com a linhagem consanguínea após este ponto. Mutantes mantidos por cruzamentos entre si podem resultar na fixação de novas mutações dentro da cepa e, portanto, devem ser evitados. Ao longo da reprodução, cepas nocaute ou transgênicas genotipadas por PCR devem ser verificadas ocasionalmente por Southern blotting, uma vez que os caprichos da PCR fizeram com que mais de um laboratório perdesse um mutante. As cepas transgênicas freqüentemente perdem a expressão do transgene irreversivelmente por meio da metilação do local de inserção, portanto, é aconselhável verificar a expressão das linhas transgênicas em cada geração. Criopreserve sua cepa, se ela não for uma das cepas comuns disponíveis comercialmente. A criopreservação está disponível no local (Case Transgenic e Targeting Facility e serviços comerciais (Jax Charles River). Em alguns casos, a maior robustez e reprodução de uma cepa exangue como CD1 (de Charles River) é uma vantagem suficiente para compensar a heterogeneidade do antecedentes, digamos, por exemplo, em estudos de embriogênese.

Algumas das cepas comumente usadas para fazer camundongos transgênicos são cegas (FVB / NJ) ou segregam um gene para cegueira (B6SJLF1 / J e B6CBAF1 / J). A cegueira nessas cepas é causada por degeneração retiniana recessiva por desmame devido ao Pde6b rd1 mutação. Uma lista das cepas afetadas e uma discussão sobre como lidar com esse problema estão aqui.

Muitas cepas consanguíneas (incluindo C57BL / 6J) têm perda auditiva 1 relacionada à idade (Ahl1) mutação, que causa degeneração da audição a partir dos 10 meses de idade, dependendo da origem genética (Johnson et al., (2000) Genomics 70: 171).

Que tamanho devo manter uma colônia de ratos?
O tamanho da colônia de ratos depende de suas necessidades. Dados os custos de manutenção de ratos, você deve manter sua colônia tão pequena quanto possível. Para cepas que você não está usando atualmente, uma pequena colônia de reprodução com várias gaiolas é suficiente (deixá-la chegar a uma gaiola é viver no limite - não faça isso). Os camundongos que não se reproduzem são um beco sem saída, portanto, certifique-se de que, se você reduziu a quantidade de uma linhagem ao mínimo, os camundongos sejam férteis e jovens. Programe a criação de criadores substitutos de forma que eles possam ser substituídos quando tiverem 6 a 8 meses de idade. A criopreservação de mutantes e cepas é altamente recomendada como seguro contra perdas acidentais. A estrutura de uma colônia de reprodução dependerá de suas necessidades. Para aqueles que precisam de acasalamentos cronometrados, um conjunto de machos reprodutores alojados individualmente e gaiolas para fêmeas não grávidas alojadas cinco em uma gaiola são essenciais. Para a manutenção de estoques por procriação, os pares reprodutores (macho e fêmea e ninhada) também costumam fazer parte da colônia. Uma boa discussão sobre estratégias de criação eficientes para atender às suas necessidades é fornecida pelo UC Irvine Transgenic Core.

Quão extensos meus registros de criação devem ser? O que devo rastrear?
Suas necessidades particulares determinarão o nível de detalhes de que você precisará em seus registros de criação. Com grandes colônias, a manutenção de registros detalhados pode consumir recursos significativos. No entanto, registros detalhados são essenciais para resolver os problemas quando eles surgem. Os registros podem ser mantidos em uma combinação de cadernos de laboratório e cartões de gaiola, em bancos de dados construídos pelo usuário, em bancos de dados construídos para fins comerciais (Bigbench Mouse, software de pedigree da Progeny's) ou em bancos de dados gratuitos (Laboratory Animal Management System (LAMS)) ou em um Banco de dados FileMaker, usando modelos fornecidos por outros Caleb Davis 'MouSeek, vários modelos de banco de dados FileMaker construídos por diferentes laboratórios.)

Como faço para enviar / receber ratos?
Todos os camundongos a serem recebidos no CWRU de instituições que não sejam fornecedores comerciais aprovados devem ser aprovados para recebimento pelo ARC. O Formulário do Fornecedor Não Padronizado (que pode ser baixado como um arquivo pdf aqui deve ser preenchido, um relatório de saúde dos ratos deve ser enviado e um veterinário CWRU ARC deve aprovar o envio. O envio deve ser direcionado ao departamento de recebimento da Health Sciences Animal Instalação. Assim que você for aprovado para envio pelo veterinário, ele fornecerá o endereço para recebimento. Em nenhuma circunstância os camundongos devem ser recebidos sem aprovação prévia. Dependendo do status do patógeno dos camundongos, eles podem ser aprovados para recebimento no quarentena limpa ou suja. Uma das principais fontes de patógenos de camundongos são os camundongos recebidos de pesquisadores de outras instituições. Os métodos usados ​​para o monitoramento de agentes infecciosos são relativamente insensíveis e a exposição de camundongos a patógenos pode ocorrer durante o transporte. A melhor maneira de garantir que os patógenos sejam não introduzida é para rederiver a cepa de entrada. O estado de saúde de todos os camundongos que não são de fornecedores comerciais é analisado pelo ARC, e eles vão decidir se é necessário rederivação ou tratamento antes de sair da quarentena. A rederivação de camundongos pode ser realizada pelo Case Transgenic and Targeting Facility. A maneira mais rápida de enviar e recuperar é enviar embriões congelados ou espermatozóides, ou embriões pré-implantação vivos. Os embriões pré-implantação podem ser enviados criopreservados em nitrogênio líquido ou como blastocistos em temperatura ambiente por entrega durante a noite. Entre em contato com um serviço de transgênicos sobre criopreservação e remessa de embriões congelados ou em temperatura ambiente. Alternativamente, ratos vivos podem ser enviados. Os contêineres de transporte para ratos podem ser adquiridos na Taconic e na Zivic Miller. Alimentos e água podem ser fornecidos com os pacotes "Napa Nectar", disponíveis na Lenderking. Você deve estar ciente de que o transporte de mulheres no primeiro terço da gravidez geralmente resulta na reabsorção dos embriões. Lembre-se da previsão do tempo ao enviar: você não quer enviar em ambientes extremos de frio ou calor. Quando você envia ratos para outras instituições, elas vão querer saber o estado de saúde de seus ratos e provavelmente entrar em contato com a equipe veterinária da ARC.

O ARC pode ajudar no envio de ratos para outras instituições (formulário de exportação de fornecedor não padrão). (Algumas instituições aceitarão informações de saúde apenas do biotério, não do IP remetente.)

Como faço para manter os ratos livres de patógenos?
Existem vários níveis diferentes de controle de patógenos. Esses níveis vão desde as operações comerciais que fornecem alojamento axênico (estéril) e gnotobiótico (flora definida), às instalações atímicas e ultrabarrier em CWRU, os sistemas de rack ventilados da Health Sciences Animal Facility e da Wolstein Mouse Facility, Microisoladores estáticos até gaiolas convencionais . A maioria dos camundongos no CWRU são livres de patógenos específicos. Os procedimentos que você precisa seguir são definidos pelo ARC e dependerão do tipo de alojamento. No entanto, algumas regras gerais podem ser observadas em todos os casos. Você deve considerar que os patógenos de camundongos serão mais prevalentes em camundongos e, portanto, o contato com camundongos que são portadores de patógenos em potencial deve ser evitado: nenhum roedor de estimação em casa escapou e camundongos selvagens em colônias devem ser presos imediatamente evite o contato com camundongos conhecidos por serem portadores patógenos.

Onde obter mais ajuda.

UC Irvine University Transgenic Core tem um excelente guia para criação e reprodução de camundongos

Guia do núcleo transgênico da Universidade de Michigan para reprodução de camundongos transgênicos e knockout

O Laboratório Jackson tem um Manual de estratégias de criação de camundongos (.pdf)

O rato como sistema modelo, informação por nós compilada sobre a genética e a biologia do rato.

O CWRU ARC oferece treinamento prático em técnica de microisolador e manuseio de mouse.

Informações úteis sobre os antecedentes e o lado prático da genética de camundongos podem ser encontradas em Lee Silver's Mouse Genetics, agora publicado online pelo Jackson Laboratory.

Hogan, B. L. M., Beddington, R., Costantini, F. e Lacy, E. (1994). & quotManipulando o embrião do mouse. A Laboratory Manual. & Quot Cold Spring Harbor Press

Hetherington, M., Doe, B. e Hay, D. (2000). Cuidados e manejo de camundongos. In: "Mouse Genetics and Transgenics: A Practical Approach." Jackson, I. J. e Abbott, editores C. M.. Imprensa da Universidade de Oxford.


Os cérebros desenvolvem novas células após os 13 anos? Novo estudo polêmico diz que não

É difícil para nós aceitar a ideia de que o cérebro pára de crescer, apesar do grande corpo de evidências científicas que apóiam essa ideia. A estatística frequentemente repetida, com base em anos de pesquisa, é que o cérebro para de se desenvolver por volta dos 25 anos. Mais recentemente, uma equipe internacional de neurocientistas argumentou em Natureza que o cérebro humano para de produzir novos neurônios com a idade 13. A resposta da comunidade científica a este estudo mais recente foi significativa, para dizer o mínimo.

Em seu artigo, publicado na quarta-feira, os pesquisadores escrevem que suas descobertas “não apóiam a noção de que a neurogênese adulta robusta continua no hipocampo humano”. Em outras palavras, nenhuma das amostras de tecido do hipocampo de cérebros adultos que examinaram mostrou evidência de novos neurônios. Os cérebros dos bebês desenvolvem muitos neurônios novos, relatam, e os cérebros das crianças mais velhas ficam um pouco mais lentos. Enquanto isso, nenhuma de suas amostras de adultos mostrou evidências de novos neurônios. E é com isso que outros cientistas não concordam.

“Eles podem simplesmente não ter olhado com cuidado o suficiente”, disse Jonas Frisén, Ph.D., do Instituto Karolinska na Suécia. STAT News na quarta-feira. Frisén foi coautor de um artigo em 2015 que contradiz as conclusões do Natureza papel. E Frisén não é o único que acha que a conclusão desses pesquisadores pode ser prematura.

“There is a long history of concluding that adult neurogenesis doesn’t exist in a given species based on difficulty in identifying new neurons,” Heather Cameron, Ph.D., a principal investigator of neuroplasticity at the National Institutes of Mental Health, told O Atlantico na quinta feira. “This happened in rats and then in nonhuman primates, both of which are now universally acknowledged as showing adult hippocampal neurogenesis.”

One of the major difficulties in measuring neurogenesis in the brain is that you can’t observe it in real time. The researchers, therefore, had to settle for the next best thing: brains from recently deceased patients. Unfortunately, even when directly examining brains, the best you can do is look for molecular markers that could indicate new neurons.

“You can’t just shine light onto a skull and see it,” said Salk Institute neurobiologist Fred Gage, Ph.D., who studies adult neuroplasticity, in an interview with STAT News on Wednesday. Therefore, this evidence comes down to Como as it’s interpreted. That’s where the disagreement lies.

Despite the uproar, the authors of the paper stood by their findings. “If neurogenesis continues in adult humans, it’s extremely rare,” Arturo Alvarez-Buylla, Ph.D., a neuroscientist at University of California, San Francisco and one of the authors on the study, told O Atlantico. “It’s not as robust as what people have said, where you could go running and pump up the number of neurons.”

In recent studies, neuroscientists have demonstrated that human adult brains can indeed produce new neurons, specifically in the hippocampus, a region associated with working memory, so Alvarez-Buylla and his team will likely need much more evidence to convince the community that their findings are correct. Plenty of research has shown that neuron development drops off as people get older, but moving the finish line back to age 13 is huge. There might not be any closure to this argument yet, but future experiments will hopefully clarify exactly at what age human brains stop producing neurons — if they ever do.


How Our Skull Changes With Age And Makes Us Look Older

Young skull on left. Notice changes in size and shape of eyes and nose as we age.

In addition to changes in the appearance of our skin and volume of facial fat, our skulls change with time. These changes contribute to our aged appearance.

Our skulls are just one of the things that change as we age. There are many other changes that occur with aging.

Know this: Science has identified how our skulls change with age and several articles have been written on the subject.

The main areas that morph are our eye sockets (orbital rims) and cheekbones. These changes mostly affect the central part of our face.

As infants, the central part of our face is relatively compact. As we become young adults, more space develops in that middle part of our face. With maturity, however, changes in our orbital rims and cheekbones make our central face more compact again and closer to the proportions of infancy.

The picture above highlights the differences between the skulls of a young and older person. *

As our central face becomes more compact, the muscles, fat, and skin attached to the bones bunches together to a certain degree. What this translates to is illustrated by the following picture. This picture shows a great example of both a young and aged face with almost no overlying fat. You can clearly see the differences in the shapes of the underlying skeleton and how the skin of the older face wrinkles and folds because there is less bony support. **

Despite almost no fat and relatively good skin in both, the younger patient still looks young because of the shape and proportion of his skull.

Knowing how our skull changes with age, we can combat the signs of aging by addressing the underlying problem. Fillers like Sculptra and Radiesse, muscle relaxers including Botox, and various lasers give us the upper hand. The more we learn about how all aspects of our face change with age, the better we can become at rejuvenating it.

* Shaw RB Jr, Kahn DM. Aging of the midface bony elements: a three-dimensional computed tomographic study. Plast Reconstr Surg 2007: 119: 675–681.

** Vleggaar D, Fitzgerald R. Dermatologic implications of skeletal aging: a focus on supraperiosteal volumization for perioral rejuvenation. J Drugs Dermatol 2008: 7 (3): 209–220.

*** Fitzgerald R, Vleggar D. Facial volume restoration of the aging face with poly-l-lactic acid (pages 2–27). Dermatol Therapy 2011.


The Anti-Aging Pill

An anti-aging startup hopes to elude the U.S. Food and Drug Administration and death at the same time.

The company, Elysium Health, says it will be turning chemicals that lengthen the lives of mice and worms in the laboratory into over-the-counter vitamin pills that people can take to combat aging.

The startup is being founded by Leonard Guarente, an MIT biologist who is 62 (“unfortunately,” he says) and who’s convinced that the process of aging can be slowed by tweaking the body’s metabolism (see "Is There a Fountain of Youth in Our DNA?").

Everyone is getting older. Few are happy about it.

The problem, Guarente says, is that it’s nearly impossible to prove, in any reasonable time frame, that drugs that extend the lifespan of animals can do the same in people such an experiment could take decades. That’s why Guarente says he decided to take the unconventional route of packaging cutting-edge lab research as so-called nutraceuticals, which don’t require clinical trials or approval by the FDA.

This means there’s no guarantee that Elysium’s first product, a blue pill called Basis that is going on sale this week, will actually keep you young. The product contains a chemical precursor to nicotinamide adenine dinucleotide, or NAD, a compound that cells use to carry out metabolic reactions like releasing energy from glucose. The compound is believed cause some effects similar to a diet that is severely short on calories—a proven way to make a mouse live longer.

Elysium’s approach to the anti-aging market represents a change of strategy for Guarente. He was previously involved with Sirtris Pharmaceuticals, a high-profile biotechnology startup that studied resveratrol, an anti-aging compound found in red wine that it hoped would help patients with diabetes. That company was bought by drug giant GlaxoSmithKline, but early trials failed to pan out.

This time, Guarente says, the idea is to market anti-aging molecules as a dietary supplement and follow up with clients over time with surveys and post-marketing studies. Guarente is founding the company along with Eric Marcotulli, a former venture capitalist and technology executive who will be CEO, and Dan Alminana, chief operating officer.

The company says it will follow strict pharmaceutical-quality production standards and make the supplements available solely through its website, for $60 for a 30-day supply or $50 per month with an ongoing subscription.

“You have high-end prescription drugs up here, which are expensive,” says Guarente, gesturing upward. “And you have the nutraceuticals down there, which are a pig in a poke—you don’t know what you’re getting and you don’t know a lot about the science behind them. There’s this vast space in between that could be filled in a way that’s useful for health maintenance.”

An anti-aging pill with an ivory-tower pedigree could prove profitable. The $30 billion supplements market is growing at about 7 percent a year overall, Alminana says, and at twice that rate for online sales.

Elysium declined to name its investors, but it has some high-level endorsements. Its board includes Daniel Fabricant, former director of the FDA’s division of dietary supplements and now CEO of the Natural Products Association, a trade association. The company also has five Nobel Prize winners advising it including neuroscientist Eric Kandel, biologist Thomas Südhof, origin-of-life theorist Jack Szostak, and the 2013 laureate in chemistry Martin Karplus.

Karplus, now an emeritus professor at Harvard, said in a telephone interview that he was turning 85 this year and had asked the company to send him a supply of Basis as soon as it’s available. “I want to remind myself whether I really want to take it or not,” says Karplus.

Scientists have shown they can reliably extend the life of laboratory mice by feeding them less, a process known as “caloric restriction.” That process seems to be mediated by biological molecules called sirtuins. NAD is important because it’s a chemical that sirtuins need to do their work and is also involved in other aspects of a cell’s metabolism. In worms, mice, and people, NAD levels fall with age, says Guarente, so the idea is to increase levels of the molecule.

“NAD replacement is one of the most exciting things happening in the biology of aging,” says Nir Barzilai, director of the Institute for Aging Research at the Albert Einstein College of Medicine in New York, who has coauthored scientific papers with Guarente but is not involved in Elysium. “The frustration in our field is that we have shown we can target aging, but the FDA does not [recognize it] as an indication.”

Other experts said while NAD may decline with age, there is limited evidence that aging can be affected by restoring or increasing NAD levels. “There is enough evidence to be excited, but not completely compelling evidence,” said Brian K. Kennedy, CEO of the California-based Buck Institute for Research on Aging.

Guarente says Elysium’s pill includes a precursor to NAD, called nicotinamide riboside, which the body can transform into NAD and put to use. In addition, the pill contains pterostilbene, an antioxidant that Guarente says stimulates sirtuins in a different way. Both ingredients can already be found in specialty vitamins. “We expect a synergistic effect [from] combining them,” he says.

Guarente says Elysium plans to gradually add to its product line with other compounds shown in academic labs to extend the healthy lifespan of worms, mice, or other animals. The company will do preliminary testing to make sure the products are not toxic but will not follow the arduous FDA approval process. Vitamins and supplements can be sold over the counter as long as they contain ingredients known to be safe and don’t make overly specific health claims.

Marcotulli says the company has some anecdotal evidence that Elysium’s pills make a difference. “For older demographics, we’ve heard really interesting feedback related to levels of energy. It’s very, very useful and restorative,” he says. And he takes the pills himself. “When I don’t have a supply, I feel actually fuzzy,” he said. “It’s become a staple of my routine.”

Guarente also says he takes Basis every day, along with 250 mg of resveratrol, the red-wine compound. Guarente also exercises—though not, he says, as often as he should.

He says it doesn’t trouble him that he sees no obvious benefits yet from his supplement regimen. Too many studies in the anti-aging field, he says, are too short-term to show real benefits. Or else they study people who are already unhealthy. “I think that’s the way it would be if something is really acting to slow your progression into decrepitude—you’re not going to notice that,” Guarente says.


Introdução

Currently available imaging methods create unique opportunities for studying cortical structure and plasticity. Providing improved spatial resolution and the possibility to observe large areas of the cortex, optical tools have become a valuable alternative to standard methods in plasticity experiments, such as single-unit recordings and visual-evoked potentials [1,2,3].

Diverse approaches have been developed to provide optical access to the cerebral cortex. Implantation of a cranial window (CW) is a broadly utilized method for chronic imaging of cortical responses [4]. Despite the optimal optical resolution that the CW offers, this method nevertheless has limitations. There are two ways to implant a CW one includes drilling a hole in the skull and the other requires only bone thinning. The craniotomy required for window embedding may lead to dura regrowth, increased dendritic-spine turnover, and an inflammatory response [5,6]. Accordingly, craniotomy usually necessitates a 3–4 week delay between surgery and imaging [7]. On the other hand, bone thinning provides a relatively small area for imaging, may require re-thinning, and is mechanically vulnerable [7]. Furthermore, the area covered by a CW is limited, and it is difficult to insert a window into certain parts of the skull, such as the somatosensory area representing a front limb. Moreover, the rigidity of a CW is an obstacle for manipulations such as viral injection or drug administration.

Due to the limitations of the CW approach, a growing number of alternative methods for chronic and less invasive optical imaging have recently emerged. These methods include less penetrative skull thinning techniques [7,8], including a more advanced thinned skull reinforced by a glass window preventing bone regrowth [9,10], a silicon-based CW that allows a larger area for observation [11], and a non-invasive clear skull-cap method [12].

The visual system is a well-established model for plasticity studies. Occlusion of one eye for a short period during early postnatal life enhances the response of the primary visual cortex to the open eye at the expense of the occluded eye, a process called ocular dominance (OD) plasticity [13,14]. This ability of the nervous system to change in response to experience was long thought to be restricted to a brief postnatal period of time, known as the critical period [1,15,16]. However, recent studies have revealed that a critical-period-like OD plasticity can be reinstated in adult animals by a number of treatments, such as chronic antidepressant treatment or environmental enrichment [17,18,19,20]. Thus, the process of critical period plasticity can be investigated by reopening a natural period of OD plasticity in adulthood, even if it had already closed earlier in development.

Here, we provide a detailed description of the “transparent skull” (TS) technique, an inexpensive, rapid, and comparatively non-invasive method for preparation of the skull for chronic imaging in mice. Furthermore, we demonstrated the utility of this method for an intrinsic optical imaging experiment, and compared the data obtained against CW data. In addition, we applied the TS technique for the measurement of fluoxetine-induced plasticity in the mouse visual cortex. Our data indicates that the TS preparation provides sufficient quality for optical imaging and can serve as an alternative to CW implantation.


Clearing the Body's Retired Cells Slows Aging and Extends Life

I'm looking at a picture of two mice. The one on the right looks healthy. The one on the left has graying fur, a hunched back, and an eye that's been whitened by cataracts. “People ask: What the hell did you do to the mouse on the left?” says Nathaniel David. “We didn't do anything.” Time did that. The left mouse is just velho. The one on the right was born at the same time and is genetically identical. It looks spry because scientists have been subjecting it to an unusual treatment: For several months, they cleared retired cells from its body.

Throughout our lives, our cells accumulate damage in their DNA, which could potentially turn them into tumors. Some successfully fix the damage, while others self-destruct. The third option is to retire—to stop growing or dividing, and enter a state called senescence. These senescent cells accumulate as we get older, and they have been implicated in the health problems that accompany the aging process.

By clearing these senescent cells from mice, Darren Baker and Jan van Deursen at the Mayo Clinic College of Medicine managed to slow the deterioration of kidneys, hearts, and fat tissue. The animals lived healthier and, in some cases, they lived longer.

“The usual caveats apply—it’s got to be reproduced by other people—but if it’s correct, without wanting to be too hyperbolic, it’s one of the more important aging discoveries ever,” says Norman Sharpless from the University of North Carolina at Chapel Hill School of Medicine, who was not involved in the study.

Several chemicals can slow the aging process in laboratory organisms, but Sharpless says it's hard to think how people might benefit. “You take a drug—resveratrol, green tea, god knows what—for 30 years, and by the time you’re 80, you’re actually 70. That paradigm doesn’t work in the real world. People hate to take drugs, especially when they don’t know it’s helping them. And no pharma company would develop such a drug. If this paper is right, suddenly you have a way of taking an old organism and making it physiologically younger. You go from a prevention paradigm to a treatment one. That's something you can sink your teeth into.”

Baker and van Deursen started this line of work by accident. In 2004, they found that turning off a gene called BubR1, which they initially thought would be involved in cancer, actually revved the aging process into high gear. The mice got cataracts, developed heart problems, lost body fat, and died much earlier than usual. And they seemed to accumulate many more senescent cells.

In 2011, the team developed a way of singling out and removing those cells. Senescent cells are characterized by a protein called p16. Baker and van Deursen genetically engineered their fast-aging mice so that they would destroy all their p16-bearing cells when they received a specific drug. The results were dramatic: The senescent cells disappeared, and though the rodents still died earlier, they were bigger, fitter, and healthier when they did. Even old mice, whose bodies had started to decline, showed improvements.

“Then, the question became: What would happen if we removed those cells in a normal mouse?” says Baker.

Using the same technique, Baker and van Deursen took normal middle-aged mice and purged their senescent cells twice a week. This time, the process increased the rodents’ average lifespan by a quarter. And as they got older, they lost less body fat, had healthier hearts and kidneys, developed fewer cataracts, and stayed more active. The team tested large numbers of mice of both sexes, from two genetic strains, and raised on two different diets—and the results were always the same. This is a real improvement. It’s in real aging the last paper was in fake aging,” says Sharpless.

John Sedivy from Brown University agrees. “This issue of whether senescent cells contribute to aging has been out there for decades,” he says. “This is the first paper that I’d say is really watertight.”

Senescent cells aren’t idle. They secrete molecules that trigger inflammation and enzymes that destroy connective tissue. “We've identified 50 to 60 different molecules that these cells produce, any one of which has the potential to wreak havoc on tissues,” says Judith Campisi from the Buck Institute for Research on Aging.

This seems perverse, but there’s method to the body’s madness. Cells undergo senescence because they accumulate damage that could potentially lead to cancer, and the molecules they secrete prompt the immune system to come over and clear them. “It’s a very potent anti-cancer mechanism,” says Baker. But as we get older, the immune system falters, and senescent cells accumulate. Now, the molecules they secrete become problems rather than solutions.

Even then, senescent cells have benefits. Last year, Campisi showed that these cells help to heal wounds. And sure enough, Baker and van Deursen found that their mice heal more slowly after such cells were removed.

The worry then is that any attempt to clear senescent cells in people would have serious side effects, as well as obvious benefits. Charles Sherr from St. Jude Children's Research Hospital is also concerned about cancer. Since the p16 protein prevents tumors from arising, Sherr wonders if “the salutary effects that accompany elimination of p16+ cells would be offset later by increased cancer incidence.” Baker and van Deursen saw no signs of that in their mice, but humans live for much longer than rodents.

“There will be tradeoffs for sure, but as we drill down into the biology, we have a better chance of preserving the good side of these cells while eliminating the bad,” says Campisi.

A newly launched company called Unity Biotechnology, which counts Campisi and van Deursen among its co-founders, is working to move the team’s senescence-clearing discoveries to the clinic. “We have spent the last four years identifying a series of Achilles heels that are unique to senescent cells,” says Unity CEO Nathaniel David. “We have molecules that are 300 times more poisonous to these cells than to non-senescent ones.”

His first goal is to use these compounds to treat a couple of diseases that are likely caused by senescent cells and that are localized to specific body parts. Osteoarthritis might be a good target—David has it in his toes—and so might late-stage glaucoma. If that works, “we can start going after higher-risk stuff like healthspan,” says David.


Senolytic Therapy Alleviates Temporomandibular Joint Degeneration in Old Mice

Senescent cell accumulation appears to be a major player in the pathology of most of the joint-related issues that occur in older individuals. Senescent cells secrete signals that provoke a state of chronic inflammation, alter nearby cell behavior, and disrupt tissue structure and maintenance. Clearance of these cells reverses numerous age-related conditions and measures of aging in mice. Hence the advent of senolytic therapies that selectively destroy senescent cells is a much anticipated development in medicine. Indeed, the first such therapies are pre-existing drugs, such as the dasatinib and quercetin combination, are already in human trials, producing promising initial data, and in principle available to any individual who can convince a physician to write an off-label prescription.

Aging is one of the major risk factors for degenerative joint disorders, including those involving the temporomandibular joint (TMJ). TMJ degeneration occurs primarily in the population over 65, significantly increasing the risk of joint discomfort, restricted joint mobility, and reduced quality of life. Unfortunately, there is currently no effective mechanism-based treatment available in the clinic to alleviate TMJ degeneration with aging.

We now demonstrate that intermittent administration of the senolytic combination of dasatinib and quercetin, which can selectively clear senescent cells, preserved mandibular condylar cartilage thickness, improved subchondral bone volume and turnover, and reduced Osteoarthritis Research Society International (OARSI) histopathological score in both 23- to 24-month-old male and female mice. Senolytics had little effect on 4 months old young mice, indicating age-specific benefits.

Our study provides proof-of-concept evidence that age-related TMJ degeneration can be alleviated by pharmaceutical intervention targeting cellular senescence. Since the senolytics used in this study have been proven relatively safe in recent human studies, our findings may help justify future clinical trials addressing TMJ degeneration in old age.


The brains are constantly buzzing with electrical activity as neurons zap off signals to one another

Finally, the developing brains are enveloped in a blanket of jelly. “It’s the opposite of normal jelly – it starts off as a liquid which you pour on and it jellifies as it warms up in the incubator,” she says. The jelly mimics the tissue a brain would normally be surrounded with in an embryo – like a makeshift skull – and encourages them to develop relatively normally.

Then all you have to do is sit back and wait. Three months later, the finished product is about four millimetres across and contains around two million neurons. “A fully developed, adult mouse brain only contains four million, so you can do a lot with that number,” she says.

The brains are constantly buzzing with electrical activity as neurons zap off signals to one another – though Lancaster says this isn’t much of an achievement on her part. “It’s not very special but it does tell us that we are making functional neurons and that they are acting like neurons,” she says.

She compares it to the heart cells which scientists coaxed to beat inside a petri dish back in 2013 while heart cells are programmed to “want” to pump, neurons “want” to fire. “Even if you have a neuron by itself in a dish with no other neurons, it wants to fire so badly that it will connect to itself in order to fire,” she says.

Lancaster's team's mini brains have two million neurons - half that of a mouse (Credit: iStock)

At the moment, Lancaster’s brains aren’t thought to be able to think. Nobody understands how the activity of our brains gives rise to thoughts – and it’s surprisingly difficult to define what a thought actually is – but it might go something like this. Usually, when we’re exposed to stimulation from the outside world – smells, sounds, ideas – our brains store the information by strengthening the connections between our neurons or forming new ones. The average adult will have as many as 1,000 trillion, which together give our brains an equivalent processing power to a one trillion-bit-per-second computer.

And here’s the rub. Even with all the same components as regular brains, without a body to provide information about the world around them, the brains simply can’t develop normally. “The neurons are working but they aren’t really organised relative to one another,” she says.

Lancaster gives the example of people who are born blind. “Since they aren’t exposed to light, the part of the brain that [these signals] would normally connect up is actually not going to form,” she says.


The Cure for Aging

I f there were Guinness World Records dedicated to high-achieving rodents, Mouse UT2598 would deserve a mention. The average life span for a mouse is 2.3 years–so at age 3 and still going strong, Mouse UT2598 has a shot at beating the record for longest-lived, which stands at about 4. Translating that to a human life span, he’s hovering around the centennial mark, but on the outside, he looks no different from his much younger brethren. His fur is glossy black, he’s lean, and while he’s a bit on the small side, he’s scrappy and surprisingly active as he explores, sniffs and pokes around his cage at the University of Texas Health Science Center at San Antonio.

What gives Mouse UT2598 his edge is a compound called rapamycin, which seems to slow aging and the damage it can do, at least to certain cells. His liver and heart function as if they were far younger, and his tendons have more spring and flexibility than they should at his age. There’s also less evidence of tumors in his organs than is considered normal, so he could be spared the effects of cancer for quite a while longer. Place him alongside other mice his age, and the contrast is unmistakable.

The experiments involving Mouse UT2598 and rapamycin are just one example of the kind of research into aging that’s producing new findings–and raising new questions–every day. In labs around the world, researchers are testing all sorts of agents, some of which already exist as drugs to treat human conditions (rapamycin is given to transplant patients to prevent organ rejection after surgery) and some of which are purely experimental. Scientists are also toying with ways to manipulate genes and pull out aging cells, all in a race to find a way to extend longevity to its outer limits.

These efforts mark a new push to examine the basic mechanisms of aging and find ways to counteract–or “cure”–them. And they are anything but fringe. Longevity research is being conducted by respected scientists with sound reasons for staking their careers on the hubristic notion that it’s possible to slow down aging and maybe even reverse it.

“When I got into the field, the notion that you could actually do something about the aging process was viewed as a crackpot idea,” says Richard Miller, director of the Glenn Center for the Biology of Aging at the University of Michigan. “The argument that one can slow aging, and diseases of aging along with it, used to be fantasy, but now we see it like a scientific strategy.”

Nobody is talking about living forever. But as these experts see it, aging is the single most powerful factor in the diseases that are most likely to cut our lives short: cancer, heart problems, immune disorders and degenerative brain conditions like Alzheimer’s. “Everybody knows that the main risk factors for heart disease are high cholesterol, obesity and high blood pressure,” says Dr. Felipe Sierra, director of the division of aging biology at the National Institute on Aging (NIA). “But even stronger than those factors is just being 70 years old.”

And that’s why staving off aging–or at least slowing it–has become such a central focus of research. “We’re going at aging itself,” says David Sinclair, a geneticist at Harvard Medical School. “We might take someone who is showing signs of aging and be able to do something about it, to treat that as a disease. That’s something I didn’t expect to be seeing in my lifetime.”

A Modern Antiaging Elixir

Mouse UT2598’s longevity diet laced with rapamycin traces its existence back to some dirt samples collected in 1964 on an expedition to Easter Island. Those soil samples became the basis for developing a new antibiotic, which was named rapamycin. Researchers noticed that mice that were given the drug tended to live longer–by about 20%, compared with those that weren’t taking it.

“Rapamycin is neat because it works in a wide variety of species, from yeast, worms and flies to mice,” says David Harrison, who is studying the compound at the Jackson Laboratory, where scientists mine the genome for solutions to human diseases. He and Miller, along with Randy Strong–in whose lab Mouse UT2598 resides–are also testing other agents in a program sponsored by the NIA.”Rapamycin is also neat because it works even when you start quite late in life.”

Because of a delay in formulating rapamycin so it remained stable in mouse chow, the first animals to try it were already getting gray–they were 20 months old, or the equivalent of 60 years in people–but they still showed slower aging once they took the compound. If the research eventually leads to a human treatment, that could bode well for older people they could potentially enjoy the same benefits that this lucky mouse is experiencing, even if they start in their 60s or 70s.

It turns out that rapamycin interrupts the function of a gene called mTOR, found in both mouse and man, which acts as a traffic signal for directing how cells take in and use energy. If there’s plenty to eat, the gene is busy greenlighting cells to absorb nutrients and grow, grow, grow. When food gets scarce, the gene goes quiet, halting the cell-growing machinery until the next feeding time. While mTOR may explain, in part, the phenomenon of calorie restriction and its ability to prolong life–in the 1930s, studies in mice showed that cutting back on their daily diet could add nearly a year to their lives–there’s also evidence that it taps into other energy-related pathways to longer life as well.

The more active state–the one in which cells are processing nutrients and growing–turns out to age cells considerably: as our cells are working hard to process our food, they also spew out toxic free radicals. The goal, then, is to keep mTOR as subdued as possible, preferably without requiring animals to starve themselves miserable. And that’s what rapamycin appears to do.

So far it’s the most promising compound under study, and Harrison and his colleagues are optimistic, though cautious, about its future. After all, resveratrol, a compound found in grapes and red wine, showed early promise in mice that gorged on high-fat diets, extending their lives, but it wasn’t as impressive in helping animals on normal diets live longer. (Researchers aren’t ready to give up on it yet, however, and it’s still being studied at GlaxoSmithKline.)

While rapamycin dials up one antiaging circuit, it’s clear that it is not yet a fountain of youth. “I’m 72, but I’m not popping rapamycin pills yet,” says Harrison. Consider the downsides. In mice, it has resulted in a body size that is about 30% smaller than average, and mTOR-regulated mice were also more likely to develop cataracts and were more prone to diabetes. The males tend to experience gradual loss of testicular function–not exactly a selling point for a future longevity treatment.

Human patients who took the drug after kidney transplants to lower their chances of rejecting the organ, for instance, also had slightly higher chances of developing diabetes, and the risk of cataracts requires more study before a broad application of the drug would be possible. Still, given the fact that rapamycin is already approved and safely taken by patients, antiaging researchers are hopeful that they’ll be able to arrive at the right doses to tip the balance in favor of longevity while minimizing potential risks.

Find the Switches to Flip

For other researchers, the key to longevity may be in our genes. Telomeres are the timekeepers of a cell’s life each time a cell divides, it copies its chromosomes’ DNA, and like a knot tied at the end of a thread, telomeres signal the end of the copying process. With each cell division, these little squiggles, which are the final segments of DNA at the ends of chromosomes, shorten–eventually disappearing altogether. And because certain things like exposure to UV light can cause telomeres to shorten at different rates, they’re a target of lots of new antiaging research too. (For more on how telomeres are being studied, see page 80.)

In healthy people there is a balancing dance between the shortening of telomeres and the work of an enzyme called telomerase, which lengthens them just a little bit, to restore some of the DNA that’s lost. But that doesn’t happen in people with telomere-syndrome conditions–which includes some bone problems, liver failure and immune-system disorders. It’s what makes those terrible conditions research gold for antiaging scientists. If they can figure out how to correct the misbehaving telomeres in those people, they may be able to correct them in normally–but inexorably–aging people too.

Twelve years ago, Dr. Mary Armanios met her first patient with such a condition while she was training with Carol Greider, a scientist who shared a Nobel Prize for the discovery of the enzyme telomerase. Through their lab at Johns Hopkins School of Medicine, Armanios met a college student with a blood disorder that required regular transfusions. He was in his 20s but had a shock of gray hair that had first appeared when he was 9. This alone was unusual, but his family history also intrigued her. Almost all his relatives on his father’s side died young. His paternal grandmother, who had severe osteoporosis and bone disorders, died in her 60s. His father died at 59 while waiting for a liver transplant. His aunt and uncle died of pneumonia in their 60s. The young man, too, had been in and out of hospitals most of his childhood to treat infections. He eventually died, at age 31, of a staph infection.

“The cosmetic symptom was hair graying, but they all have a form of hair graying in other organs as well,” says Armanios. It turned out that the family members all had dyskeratosis congenita, a rare condition with an extreme form of telomere dysfunction.

Armanios is confident she might learn something about how telomeres are supposed to work–and even how they might be manipulated and extended to halt aging-related problems, not just in those with dyskeratosis congenita but in healthy older populations as well.

One strategy may involve dousing cells with the right genetic ingredients to lengthen telomeres, as Helen Blau and her colleagues have done in petri dishes at Stanford University. “We turned back the clock on the cells by the equivalent of many years in human life,” Blau says.

Even more encouraging, the cells didn’t continue to divide indefinitely, which might raise concerns about uncontrolled growth, as occurs in cancer. “They start to [deteriorate] normally, and that bodes well for safety,” she says. Eventually, Blau hopes the cells will be tested in the liver or lungs of patients with dyskeratosis congenita, where they can target the rapidly aging cells. If that is successful, the same techniques might turn back the clock on aging cells in the rest of us.

But there might even be a quicker–if odder–way to defy aging that literally exploits the power of young blood. Relying on an innovative technique in which young and old mice can be conjoined, Siamese twin–style, to share the same blood system while keeping everything else separate, Amy Wagers at the Harvard Stem Cell Institute found something in the blood of younger mice that seems to rejuvenate an aging animal. The older mice that were yoked to the younger ones showed more new nerve-cell growth in their brains, their muscles were stronger, and in one study, some of the enlarging of the heart that comes with aging was reversed. “Their tissues are functioning more like younger tissues,” she says.

What appears to be one of the secret ingredients here is GD11, a protein that’s abundant in young animals’ blood but is scarcer in older ones. Wagers is conducting more studies in both animals and people to see if longer-lived people have higher levels of GD11 or whether people with low GD11 might be more vulnerable to age-related diseases such as heart problems, cognitive decline and muscle atrophy.

And GD11 isn’t alone in showing such promise. At the University of California, San Francisco, neurobiologist Dena Dubal is investigating a hormone called klotho, named after the Greek fate responsible for spinning the thread of life for mortals. Increasing the klotho levels in mice helps animals live 30% longer, and 1 in 5 people also carries a version of the klotho gene that boosts its amounts. On average, those individuals live an extra three to four years. It’s not the hormone of immortality, but it’s a start.

Manipulating klotho, GD11, telomeres or any of the longevity genes could involve some invasive and high-tech interventions, including gene therapy and even cell transplants. But what if all those efforts are overthinking the solution, and it’s possible to put the brakes on aging by simply removing aging cells, like plucking out gray hairs? That’s what Dr. Jan Van Deuren and his team are pursuing at the Mayo Clinic. By seeking and pulling out dying cells in the muscle, fat and eyes of mice, he’s helping them live longer than control animals. “We’re getting rid of a cell type you don’t have when you’re born, something that accumulates over time that may not really be needed for survival,” he says.

He is the first to admit that there is still plenty about that strategy–as well as other promising aging interrupters–that scientists don’t understand. For example, are rapamycin-fed mice living longer because their cells are actually functioning like younger ones or because they’re simply delaying aging conditions like cancer and heart disease? Are the old mice infused with young blood truly young again, or are their rejuvenated cells only temporarily acting more youthful? And while we know more every day about the roles telomeres play in the aging process, is the answer as simple as finding ways to safely lengthen them through drugs? They aren’t easy questions to answer, but aging experts welcome them.

That’s because what’s happening in these labs is not just about extending a life indefinitely but rather extending a healthy life for a little bit longer. And researchers say they’re truly optimistic that breakthroughs will come in their lifetime. After all, says Harrison, “It must not be all that complicated, or we wouldn’t be having the success that we’re having.”


Assista o vídeo: Najlepsza Pułapka na Szczury!!! (Agosto 2022).