Em formação

É possível expressar os cistrons de um fragmento de inserção policistrônico em um único plasmídeo?

É possível expressar os cistrons de um fragmento de inserção policistrônico em um único plasmídeo?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Tenho um fragmento de inserção que desejo expressar de pUC19 em Escherichia coli. O fragmento de inserção é uma subseção de uma sequência de operon maior e contém apenas os dois últimos cistrons desse operon.

Pretendo inserir este fragmento em pUC19 sob o controle de seu único promotor lac. Portanto, haverá dois cístrons sob o controle de um único promotor (que é, obviamente, muito semelhante a como seria expresso no operon WT).

Em minha mente, expressar ambos os cistrons sob o controle do único promotor lac pUC19 deve permitir que ambos os genes sejam traduzidos; uma vez que o mRNA é transcrito, ambos os cistrons têm seus respectivos sítios de ligação de ribossomo a montante de suas ORFs e devem ser traduzidos.

Minha pergunta é: alguém já teve experiência em expressar fragmentos policistrônicos de plasmídeos usando apenas um único promotor para o fragmento inteiro? Não consigo ver nenhum problema gritante nisso em teoria, mas pensei em perguntar antes de prosseguir. Em última análise, prefiro expressar ambos os cistrons de um único plasmídeo, em vez de expressar cada cistron em um plasmídeo separado.

Saúde! Izaak


Se bem entendi, você está buscando opção pela expressão policistrônica. Você já pensou em usar sequências T2A ou P2A? Estes vêm do vírus e essencialmente quebram o polipeptídeo em duas partes, os chamados auto-clivagem péptido T2A. O verdadeiro mecanismo de seu trabalho é que o ribossomo para na sequência e é incapaz de criar uma ligação peptídica, efetivamente reiniciando a tradução com o próximo após o aminoácido T2A.

Claro, você perde o controle independente sobre a expressão, ambos os produtos serão expressos no mesmo nível (mas a degradação pode ser diferente).

Portanto, você deve considerar a criação de uma construção semelhante a esta:

laca: gene1-T2A-gene2-stop

O fato é que a) pode não funcionar em E.coli eb) pode não ser necessário, porque o objetivo principal do T2A é igual nível de expressão de dois polipeptídeos. E, se seus 2 genes são grandes, para bactérias é mais fácil lidar com dois plasmídeos separados, em vez de um, mas muito maior.


Células-tronco pluripotentes induzidas geradas a partir de células-tronco derivadas de adipose humana usando um plasmídeo policistrônico não viral em condições livres de alimentador

As células-tronco pluripotentes induzidas (iPSCs) podem ser geradas a partir de células somáticas por expressão ectópica de fatores de transcrição definidos (TFs). No entanto, o tipo de célula ideal e as abordagens de reprogramação fácil que minimizam as aberrações genéticas das células parentais devem ser considerados antes de gerar as iPSCs. Este artigo relata um método para gerar iPSCs a partir de células-tronco adiposas humanas adultas (hADSCs) sem o uso de uma camada de alimentação, por expressão ectópica dos fatores de transcrição definidos OCT4, SOX2, KLF4 e C-MYC usando um plasmídeo policistrônico. Os resultados, baseados na expressão de marcador pluripotente, demonstraram que as iPSCs possuem características semelhantes às das células-tronco embrionárias (ESCs). Os iPSCs diferenciados em três camadas germinativas embrionárias, ambos em vitro por geração de corpo embrióide e na Vivo por formação de teratoma após ser injetado em camundongos imunodeficientes. Mais importante ainda, o DNA de plasmídeo não se integra ao genoma de iPSCs humanos, conforme revelado por experimentos de Southern blotting. A análise cariotípica também demonstrou que a reprogramação de hADSCs pelos fatores definidos não induziu anormalidades cromossômicas. Portanto, esta tecnologia fornece uma plataforma para estudar a biologia de iPSCs sem vetores virais e pode superar a rejeição imunológica e preocupações éticas, que são as duas barreiras importantes das aplicações ESC.

Citação: Qu X, Liu T, Song K, Li X, Ge D (2012) Induced Pluripotent Stem Cells Generated from Human Adipose-Derived Stem Cells Using a Non-Viral Policistronic Plasmid in Feeder-Free Conditions. PLoS ONE 7 (10): e48161. https://doi.org/10.1371/journal.pone.0048161

Editor: Andrea Barbuti, Universidade de Milão, Itália

Recebido: 2 de abril de 2012 Aceitaram: 21 de setembro de 2012 Publicados: 26 de outubro de 2012

Direito autoral: © 2012 Qu et al. Este é um artigo de acesso aberto distribuído sob os termos da Creative Commons Attribution License, que permite o uso irrestrito, distribuição e reprodução em qualquer meio, desde que o autor original e a fonte sejam creditados.

Financiamento: Este trabalho foi apoiado pela Fundação Nacional de Ciências Naturais da China (31170945) e pelos Fundos de Pesquisa Fundamental para as Universidades Centrais da China (NO. DUT11SM04). Os financiadores não tiveram nenhum papel no desenho do estudo, coleta e análise de dados, decisão de publicar ou preparação do manuscrito.

Interesses competitivos: Os autores declararam que não existem interesses conflitantes.


1. Introdução

A infecção crônica pelo vírus da hepatite B (HBV) é um sério problema de saúde pública global que precisa de terapias aprimoradas. Embora uma vacina eficaz esteja disponível, mais de 350 milhões de pessoas em todo o mundo e 1,25 milhão de pessoas nos EUA estão cronicamente infectadas. A infecção de longo prazo leva a um alto risco de progressão para cirrose e carcinoma hepatocelular e essas doenças são responsáveis ​​por até 1 milhão de mortes a cada ano (Lee, 1997 OMS, 2000).

As terapias atualmente aprovadas para o HBV são interferons, que atuam como imunomoduladores, e análogos de nucleosídeo / nucleotídeo, que atuam como inibidores da polimerase viral (Zoulim, 2006 Lok e McMahon, 2007). Em geral, essas terapias sofrem de uma série de limitações, como eficácia incompleta, baixa tolerância do paciente, regimes de tratamento demorados e a seleção de mutantes de escape viral. Enquanto esses problemas estão sendo resolvidos, em parte, com o desenvolvimento contínuo de novos inibidores da polimerase de nucleosídeos com eficácia e perfis de resistência aprimorados, é claro que uma abordagem nova e diferente para a terapia do VHB pode dar uma contribuição importante para o tratamento desta doença.

Interferência de RNA (RNAi) é um processo pelo qual a expressão gênica pode ser silenciada de uma maneira específica de sequência, tornando-se uma ferramenta poderosa que está sendo perseguida em muitas aplicações terapêuticas. Estratégias antivirais baseadas em RNAi são particularmente atraentes, uma vez que a infecção produz um conjunto único de transcritos virais que podem servir como alvos terapêuticos. Certos aspectos da biologia e patologia do HBV o tornam um bom candidato para terapias baseadas em RNAi (Lee, 1997 Romano et al., 2006). Por exemplo, o vírus se replica por meio de um intermediário de RNA, portanto, os RNAs de interferência podem diminuir diretamente a replicação viral e a produção de partículas virais infecciosas. Além disso, o grande excesso de antígenos virais, em relação às partículas infecciosas, produzidos por hepatócitos infectados de formas epissômicas ou integradas do genoma viral, é um componente significativo da patogênese e persistência do VHB mediada pela resposta imune (Chisari e Ferrari, 1995) . A capacidade de reduzir a produção de antígenos virais silenciando mRNAs virais é uma característica importante das estratégias baseadas em RNAi que não é compartilhada por inibidores análogos de nucleosídeos da polimerase do VHB (Romano et al., 2006).

O valor potencial das abordagens baseadas em RNAi no tratamento da infecção por HBV foi demonstrado em muitos estudos que usaram RNAs interferentes para regular negativamente os transcritos virais em cultura de células e modelos animais de infecção (revisado em (Radhakrishnan et al., 2004)) . Os RNAs de interferência que têm como alvo o VHB foram transfectados em hepatócitos cultivados como RNAs de interferência curtos pré-formados, sintéticos (siRNAs) (Hamasaki et al., 2003) ou como plasmídeos que expressam RNAs em grampo curto (shRNAs) (Shlomai e Shaul, 2003 Liu et al., 2004 Zhang et al., 2004 Moore et al., 2005 Romano et al., 2006). Em uma variedade de modelos de infecção de camundongo, os RNAs interferentes direcionados ao VHB reduziram a produção de antígeno viral, transcrito ou DNA quando entregues como siRNAs ou como shRNAs expressos a partir de plasmídeos ou vetores virais (Giladi et al., 2003 McCaffrey et al., 2003 Morrissey et al., 2005 Uprichard et al., 2005 Romano et al., 2006 Ying et al., 2007). Embora muitos métodos tenham sido bem-sucedidos em estudos de laboratório, continua sendo um desafio entregar agentes de RNAi aos hepatócitos de uma maneira que seja clinicamente relevante em pacientes humanos.

No presente trabalho, descrevemos um novo vetor projetado para processamento eficiente de vários RNAs interferentes a partir de um único transcrito que pode ser expresso a partir de um promotor de RNA polimerase II com potencial para expressão específica de tecido. O vetor incorpora muitas características de organização de genes de microRNA endógenos (miRNA) que estão se mostrando úteis para o desenvolvimento de reagentes para RNAi. Esperamos que a expressão e potência aumentadas de RNAs interferentes em hepatócitos aumentem o progresso contínuo no desenvolvimento de formulações para entrega dirigida ao fígado. Além disso, a expressão de múltiplos RNAs de interferência a partir de um único transcrito pode fornecer direcionamento contra uma variedade de serotipos de HBV e proteção contra a seleção de mutantes de escape viral.


Resultados

A expressão do sRNA RyhB reduz o nível de transcrição iscSUA e aumenta iscR transcrição sob depleção de ferro

O sRNA RyhB promove a degradação de um grupo de mRNAs que codificam proteínas que usam Fe (Massé e Gottesman, 2002 Massé et al, 2003, 2005). Em um experimento anterior projetado para determinar novos mRNAs direcionados pelo sRNA, observamos que RyhB regulou negativamente a seção 3 'do iscRSUA mRNA policistrônico (mostrado na Figura 1A), iscSUA, ao deixar o rio acima iscR seção intacta (Massé et al, 2005). Confirmamos esses resultados com reação em cadeia da polimerase em tempo real quantitativa (PCR), em que a expressão de RyhB diminuiu significativamente iscS níveis de transcrição sem afetar iscR níveis de transcrição (dados não mostrados). Para investigar este mecanismo de induzido por RyhB iscRSUA descoordenação do policistron, extraímos o RNA total do tipo selvagem e ΔryhB células cultivadas em meio Luria-Bertani (LB) na presença do quelante de ferro, 2,2′-dipiridil (dip), que induz RyhB e iscRSUA expressões (ver a seção Introdução Massé e Gottesman, 2002). Em seguida, carregamos Northern blots com sondas específicas para iscR e transcrições de RyhB. Como mostrado nos painéis do meio da Figura 1B, o sRNA RyhB é fortemente expresso em células de tipo selvagem após a adição de mergulho. Nos borrões do norte realizados com o iscR-sonda específica (Figura 1B, painéis superiores), duas bandas distintas são detectadas. A primeira é uma banda de baixo peso molecular correspondente a iscR sozinho e uma segunda banda de maior peso molecular correspondente ao comprimento total iscRSUA. A co-migração com um marcador de peso molecular de RNA mostra a diferença de comprimento entre as duas bandas observadas (Figura Suplementar S1C). Apesar de iscR banda é bastante significativa nas células do tipo selvagem, é fraca no ΔryhB células (compare o painel esquerdo com o painel direito na Figura 1B). Seja em tipo selvagem ou ΔryhB células, o nível de iscRSUA a transcrição diminui após 10-20 min, presumivelmente por causa da recuperação da homeostase intracelular do ferro e da repressão Holo-IscR ativada (consulte a Discussão para obter detalhes). Quando usamos as mesmas amostras de RNA para realizar o Northern blot com um iscS- sonda específica, apenas o comprimento total iscRSUA fragmento foi detectado (como mostrado na Figura Suplementar S1B). Isso indica que ambos iscR e iscRSUA Os mRNAs existem como moléculas individuais na célula.

Em seguida, investigamos a expressão de estado estacionário do iscRSUA transcrito em tipo selvagem e ΔryhB células cultivadas em meio M63 mínimo sem ferro, o que permite a expressão constitutiva de RyhB em células de tipo selvagem (Figura 1C, painel do meio). O painel superior da Figura 1C mostra que, embora o iscR transcrito é mais abundante na cepa do tipo selvagem (painel esquerdo), o comprimento total iscRSUA transcrição torna-se dominante no ΔryhB mutante (painel direito). Ao contrário dos resultados obtidos no meio LB, o iscRSUA a expressão é muito estável em ΔryhB células cultivadas em meio M63 sem ferro (compare a Figura 1B e C). Isso sugere que IscR permanece sob a forma Apo e não reprime o isc operon. Tomados em conjunto, esses resultados indicam que RyhB promove a expressão específica do iscR transcrição e reduz significativamente o comprimento total iscRSUA nível de transcrição.

A estabilidade do transcrito iscRSUA é diminuída pelo sRNA RyhB

RyhB promove a degradação total de muitos mRNAs alvo (Massé et al, 2003, 2005). No entanto, nossos resultados com iscRSUA indicam que RyhB desencadeia a degradação específica dos cistrons a jusante, iscS, iscU, e iscA, sem afetar o iscR fragmento. Para investigar isso, determinamos a estabilidade específica de iscRSUA e iscR mRNAs na ausência ou presença de RyhB. No experimento mostrado na Figura 2, adicionamos mergulho na cultura por 10 min para induzir ryhB e iscRSUA expressão, seguida pela adição de rifampicina para interromper a transcrição. O RNA total foi então extraído em diferentes pontos de tempo e o RNA foi hibridizado com um iscR-sonda específica (Figura 2A). Conforme mostrado na Figura 2B, a meia-vida do iscR mRNA é quase o mesmo se RyhB é expresso (cepa de tipo selvagem: 3,70 min) ou não (ΔryhB mutante: 3,98 min). No entanto, a meia-vida do iscRSUA O mRNA é significativamente mais curto na cepa do tipo selvagem (1,45 min) do que no ΔryhB mutante (3,78 min). Este resultado indica que RyhB diminui a estabilidade do iscRSUA mRNA sem afetar iscR mRNA.

O degradossoma de RNA e a chaperona de RNA, Hfq, são essenciais para a polaridade isc induzida por RyhB

Mostramos anteriormente que a RNase E e o degradossoma de RNA estão envolvidos na degradação mediada por RyhB de mRNAs alvo (Massé et al, 2003). Testamos o papel potencial do RNA degradossoma na descoordenação induzida por RyhB do iscRSUA operon durante a depleção de ferro. Conforme mostrado na Figura 3B, a inativação do RNA degradossoma (rne131 mutante) resulta em um aumento iscRSUA nível de mRNA (compare com o tipo selvagem na Figura 3A). Curiosamente, o iscR fragmento não se acumula significativamente no rne131 mutante. Isso indica que dependente de RyhB iscR a acumulação depende da degradação parcial do iscRSUA fragmento e não na transcrição bloqueada. Não observamos uma diferença notável entre os rne131 mutante e o rne131 ΔryhB duplo mutante, indicando que o sRNA não tem efeito sem o RNA degradossoma.

O RNA chaperone Hfq é essencial para a estabilidade e função do RyhB (Massé e Gottesman, 2002 Massé et al, 2003 Geissmann e Touati, 2004 Morita et al, 2005). Para investigar o papel do Hfq no iscRSUA regulação, comparamos o efeito da indução RyhB entre o tipo selvagem e hfq células. Conforme mostrado na Figura 3C, a ausência de Hfq resulta em redução iscR nível de transcrição em comparação com o tipo selvagem (Figura 3A). Pode-se notar que o nível de comprimento total iscRSUA (em pontos de tempo 15-20 min) é significativamente mais em rne131 e hfq células (independentemente de ryhB) do que em células de tipo selvagem, mostrando o efeito crítico desses fatores na degradação diferencial do iscRSUA policistron. Além disso, esses resultados indicam que quando RyhB está ausente (ΔryhB) ou não funcional (rne131 e hfq), a isc operon não se auto-reprime eficientemente como no tipo selvagem. Isso sugere que RyhB promove a formação de Holo-IscR por preservação de ferro. Eventualmente, isso resultará na repressão transcricional do isc operon (consulte a seção Discussão para obter detalhes).

A região intergênica entre iscR e iscS forma uma forte estrutura secundária que é responsável pelo acúmulo dependente de RyhB de iscR

Para explicar o acúmulo de iscR Após a expressão de RyhB, buscamos uma estrutura secundária potencial na região intergênica de 111 nucleotídeos de comprimento entre iscR e iscS. Usando o software mfold (http://www.bioinfo.rpi.edu/applications/mfold), descobrimos que esta região intergênica pode formar uma forte estrutura secundária (Figura 4B), que é muito bem conservada entre Enterobacteriaceae como mostrado na Figura 5. Esta conservação da estrutura secundária sugere um importante papel fisiológico. A estrutura secundária também foi determinada em vitro por sondagem de acetato de chumbo (PbAc) (Figura 4A), que cliva a molécula de RNA de fita simples. Notamos que as hastes P2, P3 e P4 são protegidas contra a clivagem por íons Pb + (Figura 4A e B), indicando que são de fita dupla. Os caules P1 e P5 são clivados, sugerindo que eles formam interações mais fracas. Esta estrutura é uma reminiscência da sequência REP (consulte a seção Discussão para obter detalhes).

Para avaliar o papel potencial desta estrutura secundária, construímos um mutante (iscmut6 veja a Figura 4B para descrição), em que interrompemos a haste principal (P2). Em seguida, analisamos o efeito de RyhB no iscmut6 mutante usando o pBAD-ryhB vetor, que expressa RyhB a partir de um promotor indutível por arabinose (Massé et al, 2003). Células que transportam o pBAD-ryhB ou plasmídeos de controle pNM12 (descritos em Materiais e métodos) foram cultivados em meio M63 mínimo, o que permite a expressão constitutiva do isc operon. Embora a indução de RyhB (pBAD-ryhB) leva a uma diminuição do comprimento total iscRSUA e isctranscrições mut6, como mostrado na Figura 4C (painéis à esquerda), acúmulo de iscR fragmentos ocorrem apenas a partir do iscRSUA transcrição. Esses resultados indicam que a estrutura secundária entre iscR e iscS é necessário para o acúmulo de um iscR fragmento após a expressão de RyhB.

Em seguida, caracterizamos a extremidade 3′ da acumulação iscR Fragmento de RNA após a expressão de RyhB, realizando um experimento 3'-RACE (descrito em Materiais e métodos). Para fazer isso, usamos o RNA total extraído de células nas quais RyhB foi expresso por 30 min (ver Figura Suplementar S6 pBAD-ryhB 30 minutos).Conforme mostrado na Figura 4B, a extremidade 3′ do iscR fragmento está situado na região não traduzida entre iscR e iscS, a montante do emparelhamento com RyhB (veja abaixo). Conseqüentemente, o iscR O fragmento de RNA resultante da expressão de RyhB contém toda a ORF de iscR e, portanto, é provável que seja traduzido. Pode-se notar que a extremidade 3′ do iscR fragmento está situado a jusante da haste mais forte (P2) da estrutura descrita acima.

Emparelhamento direto de RyhB na 5′-UTR do mRNA iscS

Para investigar o efeito de RyhB no iscRSUA policistron, procuramos um possível local de emparelhamento entre os dois RNAs. Usando ferramentas de bioinformática, encontramos um emparelhamento putativo entre RyhB e o 5′-UTR de iscS (Figuras 4B e 6B), que cobre da região a montante do RBS até o primeiro códon do mRNA alvo, uma marca registrada dos sRNAs de regulação negativa (Gottesman, 2004). Para investigar o emparelhamento entre RyhB e iscS 5′-UTR, realizamos ensaios de footprinting com uma extremidade 5′ radiomarcada iscS RNA na ausência e presença de RNA de RyhB e o chaperone de RNA, Hfq. Usamos a sondagem de PbAc para visualizar o emparelhamento entre os dois RNAs, uma vez que os íons Pb + clivam especificamente o RNA de fita simples. Conforme mostrado na Figura 6A, a adição de RyhB para iscS diminui a clivagem na região do códon de início de iscS (compare as pistas 8 e 9), indicando um emparelhamento entre ambos iscS e RNAs de RyhB. O efeito do chaperone de RNA, Hfq, também foi abordado neste experimento. Na presença de Hfq, o efeito protetor de RyhB sobre iscS é aumentado (compare as pistas 9 e 11), indicando que a chaperona facilita o emparelhamento entre os dois RNAs. A adição de Hfq sozinho protege os nucleotídeos entre G103 e A107 (compare as pistas 8 e 10), sugerindo que ele se liga aos três Us localizados a jusante do iscS Sequência Shine – Dalgarno. Todos esses resultados são consistentes com o emparelhamento previsto mostrado na Figura 6B. Embora seja provável que a região entre G100 e U104 de iscS interage com RyhB, não há tal evidência, pois essa região parece resistente à clivagem de Pb + (Figura 6A).

Também testamos o RyhB–iscS emparelhamento na Vivo usando um iscRS ′lacZ fusão transcricional inserida em uma única cópia no local de integração do fago-λ do cromossomo (ilustrado na Figura Suplementar S7, consulte Materiais e métodos para obter detalhes). Como mostrado na Figura Suplementar S3, a atividade de β-galactosidase é diminuída na fusão de tipo selvagem após a expressão de RyhB a partir de um promotor indutível por arabinose. Construímos vários mutantes de iscS para interromper o emparelhamento entre RyhB e iscS, e medimos a atividade β-galactosidase na ausência ou presença de RyhB. Tivemos que transformar pelo menos sete nucleotídeos no iscS Região 5′-UTR para interromper o efeito RyhB (iscRS ′mut7-lacZ) No entanto, o mutante RyhB que é compensatório para iscRS ′mut7-lacZ não conseguiu restaurar o efeito do tipo selvagem. Isso sugere que, como a região mutada está próxima ao sítio de ligação de Hfq determinado para RyhB (Geissmann e Touati, 2004), o mutante compensatório RyhB se torna ineficaz. Juntos, o em vitro e na Vivo os resultados indicam que os pares RyhB no 5′-UTR de iscS, que é o primeiro passo para diminuir o comprimento total iscRSUA transcrição e acumulação de um iscR transcrição. O emparelhamento é particularmente forte no iscS região de códon de iniciação, correlacionando-se com nossos ensaios de footprinting acima (ver Figura 6A). Estes resultados sugerem que o emparelhamento RyhB pode perturbar o início da tradução.

Significado fisiológico da descoordenação induzida por RyhB do policistron iscRSUA

Nosso experimento 3′-RACE (Figura 4B) mostrou que o dependente de RyhB iscR fragmento contém todo o ORF de iscR. No entanto, não está claro se a tradução permanece ativa ou não. Para resolver esta questão, usamos western blots quantitativos para medir os níveis de proteínas IscR e IscS após a expressão de RyhB. Primeiro medimos o nível de estado estacionário do tipo selvagem e ΔryhB células cultivadas em meio mínimo M63 (semelhante à Figura 1C). Os resultados na Figura 7A indicam um aumento significativo (mais de duas vezes) na razão IscR / IscS, conforme as células atingiram um OD600 de 1.0. Também realizamos um experimento semelhante, mas com RyhB expresso a partir do pBAD-ryhB vetor. Conforme mostrado na Figura 7B, a expressão de RyhB (pBAD-ryhB) leva a uma diminuição significativa nos níveis de proteína de IscS. No entanto, nas mesmas condições, os níveis de IscR permanecem estáveis ​​mesmo na presença de RyhB. Estes resultados mostram um aumento de quatro vezes na razão IscR / IscS após 4 h de expressão de RyhB em comparação com o experimento de controle com um vetor vazio (pNM12), no qual os níveis de IscR e IscS não são significativamente afetados.

IscS, IscU e IscA são responsáveis ​​pela biogênese dos aglomerados Fe-S e acredita-se que transferam esses aglomerados para IscR (Schwartz et al, 2001). Quando IscR está ligado a um cluster Fe – S (Holo-IscR), ele reprime o isc promotor como um controle de feedback (Schwartz et al, 2001, consulte a Introdução para obter detalhes). No entanto, como o nível de IscS diminui após a expressão de RyhB, formulamos a hipótese de que a proteína IscR produzida nessas condições está sob a forma Apo (sem um cluster Fe-S). Para testar isso, medimos a expressão do isc promotor usando um iscR′-lacZ fusão transcricional (ilustrada na Figura Suplementar S7) inserida no local de fixação λ em uma cepa que abriga o endógeno iscRSUA operon. Conforme mostrado na Figura 7C, a expressão de RyhB a partir de um pBAD-ryhB plasmídeo leva a um aumento de duas vezes na atividade de β-galactosidase em comparação com o plasmídeo de controle (pNM12). No entanto, se excluirmos a cópia endógena do policistron (ΔiscR), não há diferença significativa nas atividades β-galactosidase com ou sem RyhB. Estes resultados sugerem que, embora RyhB infrarregule IscS, o regulador transcricional IscR permanece expresso, no entanto, sob a forma Apo-IscR.


Conclusão

Nossos resultados indicaram que o peptídeo 2A não produz efeitos citotóxicos em camundongos transgênicos que o expressam em todas as suas células ao longo do desenvolvimento e na idade adulta. Eles também indicam que as funções do peptídeo 2A em camundongos transgênicos após várias gerações de passagem através da linha germinativa e os transgenes que codificam o peptídeo 2A não mostram atenuação nos níveis de expressão ao longo das gerações. Nossos resultados também confirmaram que o peptídeo 2A medeia a 'clivagem' co-translacional em uma ampla gama de tecidos embrionários e adultos.

Juntos, isso estabelece o peptídeo 2A como viável e, sendo mais confiável e fácil de usar, uma alternativa superior ao IRES na transgênese em camundongos. Cumpre todas as funções para as quais as sequências IRES são atualmente utilizadas: expressão multicistrônica em animais transgênicos e cultura de células, expressão multicistrônica usando vetores virais em animais inteiros, expressão de sequências codificantes exógenas inseridas por recombinação direcionada em loci endógenos, etc. Além disso, também fornece a vantagem de níveis confiáveis ​​e estequiométricos de expressão, tornando-o particularmente útil quando o nível relativo de expressão de duas ou mais proteínas transgênicas é importante.

Finalmente, os camundongos transgênicos relatados aqui são úteis por si próprios para visualizar membranas celulares e núcleos em tecidos vivos e fixos. Devido à ampla expressão do transgene CAG-TAG, é provável que os camundongos sejam úteis em uma ampla gama de disciplinas. Em conjunto com a microscopia de lapso de tempo, eles representam uma ferramenta poderosa para seguir vários parâmetros celulares, como forma, volume, movimento e taxas de divisão em células cultivadas, órgãos ou embriões inteiros. A inserção fortuita do transgene no cromossomo X em uma das linhagens transgênicas torna essa linha particularmente útil no monitoramento da inativação do cromossomo X.


MATERIAL E MÉTODOS

Cepas, meios e condições de crescimento

Os procedimentos e cultivos da biologia molecular seguiram a literatura padrão (Sambrook e Russell 2001). Para fins de clonagem, usamos Escherichia coli Cepa DH5α (fhuA2Δ (argF-lacaZ) U169 PhoUMA glnV44 Φ80Δ (lacaZ) M15 giroA96 gravandoA1 relA1 fimA1 isso-1 hsdR17) cultivado em meio Luria-Bertani suplementado com ampicilina 100 μg / mL, a 37 ° C. Saccharomyces cerevisiae cepa CEN.PK113-5D (ESTEIRAumaMAL2-8 c SUC2 ura3-52 gentilmente fornecido por P. Kötter, Universidade de Frankfurt, Alemanha) foi usado para na Vivo expressão e sistema de tradução. Os pré-inóculos de levedura foram mantidos em meio YPD (extrato de levedura 1%, peptona 2%, dextrose 2%) e os transformantes foram selecionados em meio de dextrose sintética (SD 0,67% base de nitrogênio de levedura, dextrose 2%) sem uracila, a 30 ° C após transformação por choque térmico de acetato de lítio / DNA de fita simples. Os cultivos experimentais foram conduzidos no mesmo meio SD-uracil, a 30 ° C durante a noite.

Construções de plasmídeo

Os plasmídeos foram construídos com base em p416 (Mumberg, Müller e Funk 1995), um plasmídeo centromérico carregando a proteína fluorescente verde (GFP) sob o controle de TEF1 promotor CYC1 como terminador e URA3 como gene marcador de seleção. Para construir o plasmídeo de controle GFP, tCYC1 foi trocado por tADH1 usando primers sobrepostos P13_fwd e P14_rev para amplificar tADH1 fragmento enquanto [p416-PTEF1-GFP] (David, Nielsen e Siewers 2016) foi amplificado usando os primers P11_fwd e P12_rev com sobreposição para GFP e o vetor conforme recomendado pelo protocolo Gibson (Gibson et al. 2009). Os primers usados ​​neste trabalho estão listados na Tabela 1 e na Tabela S1, Informações de Apoio. O vetor e os fragmentos foram amplificados pela PrimeSTAR ® HS DNA polimerase (Takara Bio Inc, Saint-Germain-en-Laye, França) de acordo com as recomendações do fabricante. Os amplicons foram purificados e combinados em uma proporção de inserção: vetor de 3: 1 junto com a mistura Gibson Assembly ® Master (New England Biolabs, Ipswich, MA, EUA). O plasmídeo de controle da proteína fluorescente vermelha (RFP) foi construído da mesma maneira usando iniciadores (P11_fwd e P15_rev) para amplificar o vetor e PTEF1. O fragmento RFP-tADH1 foi amplificado a partir do plasmídeo modelo p0394 com iniciadores sobrepostos (P16_fwd e P14_rev).

Primers gerais utilizados neste trabalho.

Identificação do primer. Sequência do iniciador 5'– 3 '. Observação .
P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplificação com sobreposição a p416 (em negrito)
P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA
P11_fwd GGCCGGTACCCAATTCGCCCTATAG amplificação de p416 sem tCYC1
P12_rev CTATTTGTATAGTTCATCCATGCCA
P15_rev TTTGTAATTAAAACTTAGATTAGAT Tempera para PTEF1
P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA Amplificação RFP com sobreposição para p416 (em negrito)
P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward usado com primers reversos na Tabela S1. Anneals to p416. Sobrepõe-se a tADH1 (em negrito)
P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverso usado com primers diretos na Tabela S1. Tempera até o final de tADH1
Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Usado para sequenciamento e PCR de colônia com P4_rev
Identificação do primer. Sequência do iniciador 5'– 3 '. Observação .
P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplificação com sobreposição a p416 (em negrito)
P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA
P11_fwd GGCCGGTACCCAATTCGCCCTATAG amplificação de p416 sem tCYC1
P12_rev CTATTTGTATAGTTCATCCATGCCA
P15_rev TTTGTAATTAAAACTTAGATTAGAT Tempera para PTEF1
P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA Amplificação RFP com sobreposição para p416 (em negrito)
P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward usado com primers reversos na Tabela S1. Anneals to p416. Sobrepõe-se a tADH1 (em negrito)
P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverso usado com primers diretos na Tabela S1. Tempera até o final de tADH1
Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Usado para sequenciamento e PCR de colônia com P4_rev

Primers gerais utilizados neste trabalho.

Identificação do primer. Sequência do iniciador 5'– 3 '. Observação .
P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplificação com sobreposição a p416 (em negrito)
P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA
P11_fwd GGCCGGTACCCAATTCGCCCTATAG amplificação de p416 sem tCYC1
P12_rev CTATTTGTATAGTTCATCCATGCCA
P15_rev TTTGTAATTAAAACTTAGATTAGAT Tempera para PTEF1
P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA Amplificação RFP com sobreposição para p416 (em negrito)
P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward usado com primers reversos na Tabela S1. Anneals to p416. Sobrepõe-se a tADH1 (em negrito)
P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverso usado com primers diretos na Tabela S1. Tempera até o final de tADH1
Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Usado para sequenciamento e PCR de colônia com P4_rev
Identificação do primer. Sequência do iniciador 5'– 3 '. Observação .
P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplificação com sobreposição a p416 (em negrito)
P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA
P11_fwd GGCCGGTACCCAATTCGCCCTATAG amplificação de p416 sem tCYC1
P12_rev CTATTTGTATAGTTCATCCATGCCA
P15_rev TTTGTAATTAAAACTTAGATTAGAT Tempera para PTEF1
P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA Amplificação RFP com sobreposição para p416 (em negrito)
P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward usado com primers reversos na Tabela S1. Anneals to p416. Sobrepõe-se a tADH1 (em negrito)
P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverso usado com primers diretos na Tabela S1. Tempera até o final de tADH1
Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Usado para sequenciamento e PCR de colônia com P4_rev

Todas as sequências 2A foram construídas entre GFP e RFP adicionando cerca de 45-50 nucleotídeos no primer reverso (Tabela S1, Informações de Apoio) para o emparelhamento da amplificação do vetor GFP com o primer P1_fwd direto (Tabela 1). Os primers que se sobrepõem e complementam a sequência 2A por 45-50 nucleotídeos foram projetados no primer direto (Tabela S1, Informações de Apoio) para RFP-tADH1 amplificação usando o primer reverso P4_rev (Tabela 1). Os nucleotídeos que codificam as sequências 2A foram otimizados por códons para tradução de levedura. Após 30 min, a mistura de montagem foi transformada em E. coli e a montagem correta foi verificada por PCR de colônia usando DreamTaq (Thermo Scientific) de acordo com o protocolo do fabricante usando os iniciadores Fwd_GFP_5seq e P4_rev. O sequenciamento de DNA foi realizado com o primer Fwd_GFP_5seq. Os repórteres foram transformados em CEN.PK113-5D e selecionados em meio SD-uracil.

Mutação do sítio ERBV-1 2A

A mutagênese dirigida ao local foi conduzida usando [p416-PTEF1-GFP-ERBV2A-RFP] como um modelo e método de amplificação de primer único (Edelheit, Hanukoglu e Hanukoglu 2009). Os iniciadores usados ​​para promover a substituição de Pro20 por Ala foram AlaF (direto): 5'-GAATTGAATCCAGGTgctATGGCC-TCCTCCGAG-3 'e AlaR (reverso): 5'-CTCGGAGGAGGC-CATagcACCTGGATTCAATTC-3', onde minúsculas indica a substituição de aminoácido. As amplificações foram realizadas com polimerase de DNA Phusion High Fidelity (2000 U / mL New England Biolabs). Os produtos de amplificação de fita simples foram misturados e emparelhados diminuindo gradualmente a temperatura 10 ° C / min de 98 ° C para 37 ° C. As fitas duplas resultantes foram tratadas com DpnI (20 U / μL New England Biolabs) e transformado em E. coli. O sequenciamento de DNA foi realizado com o primer Fwd_GFP_5seq para confirmar a presença da mutação desejada. O repórter do peptídeo mutante 2A foi transformado em CEN.PK113-5D e selecionado em meio SD-uracil.

Microscópio Fluorescente

As cepas de levedura que expressam os repórteres foram pré-cultivadas durante a noite e, em seguida, diluídas para uma densidade óptica a 600 nm (OD600nm) de 0,1 em 20 mL de meio SD-uracil. As cepas foram cultivadas a 30 ° C e as amostras foram retiradas da fase exponencial média (OD600nm 0,5–0,8) e lavado uma vez com solução salina tamponada com fosfato (PBS). A fluorescência GFP foi detectada com um filtro 525/30 e RFP, com filtro 690/50 usando um microscópio invertido de fluorescência Leica AF 6000 (Wetzlar, Alemanha) com uma objetiva de 100 ×. As imagens foram processadas com o software Leica Application Suite.

Western blotting

Os extratos de proteína foram preparados conforme descrito anteriormente (Chen e Petranovic, 2015). A quantificação foi realizada usando RC DC Protein Assay (Bio Rad, Hercules, EUA) contra uma curva de calibração de albumina de soro bovino (Sigma-Aldrich). Um gel Bis-Tris a 4% a 12% (Invitrogen) foi usado para separar 50 μg de proteína de cada amostra por cerca de 2 h a 90 V em tampão de corrida (Tris 25 mM, glicina 192 mM, SDS a 0,1%, pH 8,3 Bio Rad). A transferência de proteínas para membrana de difluoreto de polivinilideno (PVDF) (Bio Rad) foi realizada em um sistema de transferência semi-seco (Bio Rad) usando um tampão de transferência contendo 50 mM de Tris, 38 mM de glicina, 20% v / v de metanol por 1 h em 25 V. As membranas foram bloqueadas com tampão de bloqueio (Sigma-Aldrich) por 1 h e depois incubadas com o anticorpo monoclonal primário anti-RFP (Life Technologies, Eugene, OR, EUA) ou anti-GFP (Roche Life Science) durante a noite em 4 ° C. Em seguida, as membranas foram lavadas 4 vezes com PBS-Tween 20 a 0,05%, sondadas com anticorpo anti-coelho secundário por 1 h e novamente lavadas antes da detecção por luminescência com reagente ECL Prime (GE Healthcare) e analisador de imagem ChemiDoc XRS (Bio Rad ) As intensidades das bandas nas membranas foram determinadas usando o software ImageJ. A eficiência de 'clivagem' foi calculada da seguinte forma: eficiência de clivagem = 100 × (forma de RFP clivada) / (forma de RFP clivada + forma não clivada).

Avaliação da produção de friedelina usando o sistema 2A

Sequência de codificação da Friedelin sintase de Maytenus ilicifolia (MiFRS, número de acesso GenBank KX147270) (Souza-Moreira et al. 2016) foi sintetizado por GenScript com otimização de códons para expressão em S. cerevisiae. MiA sequência de FRS foi subclonada na expressão de levedura pSP-GM1 (Partow et al. 2010) sob o controle do TEF1 promotor usando enzimas de restrição Sacoeu e SpeI (FastDigest, Thermo Fisher Scientific). A forma truncada de HMG1 gene foi clonado no [pSP-PTEF1-MiFRS] plasmídeo entre BamHeu e SalI (FastDigest, Thermo Fisher Scientific) locais de restrição sob PGK1 controle do promotor. O plasmídeo [pSP-PTEF1-MiFRS, PPGK1-tHMG1] foi usado como controle do nível de produção de friedelina na cepa CEN.PK113-5D.

Para demonstrar a funcionalidade do peptídeo 2A para aplicações de engenharia metabólica, a via biossintética de friedelina foi expressa em levedura usando o construto bicistrônico [pSP-PPGK1-MiFRS-2A-tHMG1] Para construir o plasmídeo, fragmentos de cada módulo (isto é, módulo de recombinação homóloga para partes superiores e inferiores do plasmídeo, promotor, MiFRS, tHMG1 e ADH1 terminador) foram amplificados por PCR com primers sobrepostos (descritos na Tabela S2, Informações de Apoio) usando PrimeSTAR ® HS DNA polimerase. Após a purificação do gel, os módulos foram montados por PCR em um fragmento (Zhou et al. 2012). O esqueleto de pSP-GM1 foi amplificado por PCR e purificado em gel. Molar igual de fragmento modular montado e estrutura pSP-GM1 foram quimicamente transformados em CEN.PK113-5D. PCR de colônia foi usado para rastrear a presença de plasmídeo montado. Os plasmídeos foram então recuperados dos lisados ​​celulares, transformados em E. coli e novamente recuperado para verificação de sequenciamento da construção.

Quantificação da produção heteróloga de Friedelina

CEN.PK113-5D transformado com pSP-GM1 vazio, [pSP-PTEF1-MiFRS, PPGK1-tHMG1] ou [pSP-PPGK1-MiFRS-2A-tHMG1] foram pré-crescidos em meio SD-uracil. Para a produção heteróloga de friedelina, as células foram diluídas para um OD inicial600nm de 0,05 em meio mínimo (Scalcinati et al. 2012) e cultivadas por 72 h a 30 ° C com agitação. Em seguida, as células foram coletadas, secas e cerca de 30 mg de peso celular seco foram extraídos com clorofórmio: metanol (2: 1, v / v Khoomrung et al. 2013) em banho de ultrassom (2840D, Odontobrás, Ribeirão Preto, SP, Brasil) por 10 min. A fase orgânica foi recolhida após adição de NaCl a 0,73% e centrifugação. O extrato foi seco e ressuspenso em 200 μL de acetonitrila para ser analisado por cromatografia gasosa associada à espectrometria de massa (QP2020C W / O RP230V, Shimadzu, Kioto, Japão) usando uma coluna HP-5 (30 m × 0,25 mm × 0,25 μm Agilent Technologies , Santa Clara, Califórnia, EUA). A análise foi realizada com temperatura de entrada de 270 ° C, gradiente de aquecimento de 200 ° C a 290 ° C (10 ° C / min), temperatura da armadilha de 200 ° C, temperatura de interface de 290 ° C por 18 min, volume de injeção de 1 μL, proporção de divisão de 1:10, fluxo de gás de 1,0 mL / min, ionização de 70 eV e intervalo de detecção de 35–600 m / z. O colesterol foi adicionado como controle de padrão interno a 40 μg / mL antes do processo de extração de friedelina. Uma curva analítica do padrão de friedelina (Sigma-Aldrich, St. Louis, Missouri, EUA) foi construída. O pico de friedelina foi observado no tempo de retenção de 23,08 min e a identidade foi confirmada por detecção espectral de massa em comparação com a biblioteca e padrão do Instituto Nacional de Padrões e Tecnologia (NIST). A análise de quantificação foi feita em triplicado e a significância estatística foi analisada pelo teste t de Student (valor p & lt 0,05).


Vários elementos amplamente espaçados determinam a eficiência com a qual um cistron distal é expresso a partir do RNA pregenômico policistrônico do caulimovírus do mosaico da figueira.

HERMAN K. EDSKES, † * JENNIFER M. KIERNAN, ANDROBERT J. SHEPHERD

Tobacco and Health Research Institute e Department of Plant Pathology, University of Kentucky, Lexington, Kentucky 40546-0091

Recebido em 3 de abril de 1996 / Aceito em 11 de novembro de 1996

O mecanismo de expressão policistrônica da planta pararetrovírus figwort mosaic caulimovirus (FMV)

depende de elementos cis-atuantes presentes em seu RNA pré-genômico e um proteína de ação trans (P6) que é

expresso a partir de um RNA subgenômico monocistrônico. Usando expressão transitória de policistrônico derivado de FMV

repórter constrói em Nicotiana Edwardsoniiprotoplastos de suspensão de células, analisamos ainda mais o cis-ação

elementos envolvidos na expressão policistrônica. UMAelemento de ação cis localizado dentro dos primeiros 74 nucleotídeos do

O RNA pré-genômico de 7.954 nucleotídeos parece ser essencial para P6 transativar a expressão de um cistron. A expressão deste cistron interno, na presença de P6, é bastante reforçada pela presença combinada

de doiselementos cis-atuantes localizados no 3*final do RNA policistrônico. Surpreendentemente, a exclusão da maioria

a montante desses dois 3* elementos de ação cis expuseram um elemento de ação negativa localizado internamente no

RNA policistrônico, no 3* fim do quadro de leitura I aberto. A ação de ambos os internos de ação negativa

elemento e de ação positiva 3*elementos é mais pronunciado quando o grande 5*região líder não traduzida

é presente. Isso indica que o 5* região líder não traduzida é central para a regulação do gene FMV

mecanismo de expressão. Embora um conjunto limitado de elementos seja suficiente para dirigir a expressão policistrônica neste sistema eucariótico, uma interação complexa entre os elementos está envolvida na regulação espacial dos genes presente no RNA pré-genômico do FMV.

Caulimovírus são um grupo de vírus de plantas com partículas icosaédricas que encapsidam um genoma de DNA circular de fita dupla (ds) com um tamanho de cerca de 8 kb (33, 43). Na célula da planta infectada, esse genoma de DNA pode ser encontrado no núcleo como um minicromossomo (35). No entanto, a replicação de caulimovírus ocorre no citoplasma, onde uma transcriptase reversa codificada por vírus converte transcrições de RNA de caulimovírus terminalmente redundantes em dsDNA circular (revisado na referência 44). Como o genoma do DNA do caulimovírus não se integra ao genoma do hospedeiro durante o ciclo normal de replicação, os caulimovírus foram classificados, junto com os hepadnavírus animais, como pararetrovírus (45).

Como o vírus do mosaico da couve-flor (CaMV), o membro do tipo do grupo dos caulimovírus, dois transcritos principais foram descritos para o vírus do mosaico da figueira (FMV): esses são os RNAs pré-genômicos e subprégenômicos (Fig. 1). O RNA subpré-genômico, que é gerado a partir de um promotor separado, é 39 colinear com o RNA pré-genômico e abrange apenas a região do gene VI do genoma viral (41). O RNA pré-genômico contém sete estruturas de leitura aberta (ORFs) bem espaçadas, dispostas de uma ponta à outra. Em sua extremidade 59, ele tem uma região líder não traduzida de 570 nucleotídeos (nt). De acordo com as regras convencionais de iniciação da tradução eucariótica (30), as ORFs internas no RNA pré-genômico não seriam acessíveis aos ribossomos. Além disso, além de ser altamente estruturada, a 59 região líder desta transcrição contém várias ORFs pequenas. Esses

acredita-se que as características tornam a região 59leader muito inibidora para o processo de tradução (1, 20). Foi demonstrado que o bloco de tradução da região líder do RNA pré-genômico é liberado na presença do produto proteico da ORF VI (P6) (2, 19). Além disso, construtos bicistrônicos artificiais, desprovidos de virtualmente quaisquer sequências de vírus, podem expressar o cistron a jusante na presença de P6 (13). Combinando essas duas observações, Scholthof et al. (41) mostraram que a maioria das ORFs presentes no RNA pré-genômico do FMV pode ser expressa a partir desse transcrito na presença de P6. Assim, um transativador de tradução codificado por vírus (P6) parece tornar os cistrons a jusante neste RNA policistrônico acessíveis ao processo de tradução eucariótica.

Essas observações permitem que um modelo básico para a expressão do gene de caulimovírus seja formulado, no entanto, elas não explicam por que os caulimovírus têm uma região líder tão longa e complexa, nem fornecem uma explicação para a região espacial regulada expressão de genes de caulimovírus. Dois elementos de ação cis têm foram descritos os quais auxiliam no mecanismo de expressão policistrônica de FMV. Um elemento localizado dentro da ORF VII, a única ORF sem função atribuída, demonstrou ser essencial para a capacidade de P6 de direcionar os ribossomos para contornar o bloqueio translacional imposto pela região líder (20). o segundo elemento de ação cis, localizado no 39region do RNA pregenômico do FMV, foi revelado apenas com o emprego de construções repórter multicistrônicas que se assemelham ao transcrito nativo (42). Este elemento aumentou a eficiência com a qual as ORFs distais foram expressas a partir dessas construções. Assim, parecia plausível que vários cis-elementos estão envolvidos em a expressão da transcrição policistrônica de comprimento total de caulimovírus. Além disso, os impactos relativos desses elementos podem diferir, dependendo da posição de um cistron dentro da matriz de genes, resultando na regulação espacial da expressão do gene cauli-movirus.

* Autor correspondente. Endereço para correspondência: Bldg. 8, Room 225, 8 Center Dr., MSC 0830, National Institutes of Health, Bethesda, MD 20892-0830. Telefone: (301) 496-1309. Faxe: (301) 402-0204. E-mail: Edskes @ Helix.NIH.gov.

† Endereço atual: Seção de Genética de Eucariotos Simples, Laboratório de Farmacologia Bioquímica, Instituto Nacional de Diabetes, Doenças Digestivas e Renais, Bethesda, MD 20892-0830.

Em 9 de novembro de 2019 por convidado

Http://jvi.asm.org/

Aqui, descrevemos a identificação de um conjunto de essenciais e elementos cis auxiliares que controlam a expressão do primeiro e terceiro cistrons (excluindo ORF VII) do RNA pré-genômico de FMV. Um elemento essencial para a expressão policistrônica foi identificado dentro do primeiro 74 nt do RNA pregenômico FMV. O intensificador da expressão policistrônica encontrado na extremidade 39 do RNA pré-genômico foi posteriormente dissecado e mostrou consistir em duas partes, ambas as quais são essencial para a sua atividade. Um terceiro elemento cis, agindo negativamente na expressão policistrônica, foi identificada na fronteira da ORF I e ORF II. A ação dos 39 elementos potencializadores e do elemento de ação negativa foi fortalecida pela presença da 59 região líder. Essas descobertas sugerem que o 59região líder não traduzida, auxiliada por cis-ação elementos e um transativador translacional, colocam cistrons de caulimovírus sob o controle de um mecanismo de expressão único.

MATERIAIS E MÉTODOS

Protocolos padrão.Técnicas de biologia molecular padrão foram realizadas (38). A eletroporação de protoplastos de suspensão de células de Nicotiana edwardsonii foi realizada conforme descrito por Kiernan et al. (27).

Ensaios CAT.Os ensaios de cloranfenicol acetiltransferase (CAT) foram realizados essencialmente como descrito por Kiernan et al. (27). Em suma, os protoplastos foram colhidos 24 h após a eletroporação e lisados ​​por quatro ciclos de congelamento-descongelamento em

Tris-HCl 0,25 M (pH 7,8). A eficiência da expressão transiente foi padronizada pelo ensaio da expressão da proibição-glucuronidase (GUS) a partir de uma construção repórter GUS coeletroporada (8), conforme descrito por Jefferson et al. (26) com um minifluorômetro TKO 100 (Hoefer Scientific Instruments, San Francisco, CA). Extratos de protoplastos foram incubados por 10 min a 658C, seguido pela incubação de extratos padronizados de 60 ml suplementados com 10 ml de acetil coenzima A 2 mM, 1,2531023m

C] cloranfenicol (Amersham International) e Tris-HCl 0,19 M (pH 7,8) a 378C. As incubações foram interrompidas pela extração da mistura de reação com acetato de etila em vários momentos, dependendo da eficiência de expressão transitória, geralmente após 4 h. As formas acetiladas e não acetiladas de cloranfenicol foram quantificadas com um contador de cintilação líquida Packard Tri-Carb 460 (Packard Instrument Company, Downers Grove, Ill.) Conforme descrito por Gowda et al. (19). A porcentagem de acetilação foi calculada dividindo-se a quantidade de radioatividade das formas acetiladas do cloranfenicol pela quantidade total de radioatividade de cada amostra.

Construções de plasmídeo.A numeração das sequências de FMV descritas nesta seção está de acordo com as coordenadas de nucleotídeos de FMV (36). No entanto, a maioria dos plasmídeos usados ​​na investigação foram derivados de um mutante natural do FMV no qual os genes IV e V foram fundidos devido a uma deleção de 1.237 nt (40). Os plasmídeos pH66, pH66DS, pH61, pH61DS, pH61DN, pFMV-RVI, pF20CAT, pF20VIICAT e pF32CAT foram descritos por Gowda et al. ou Scholthof et al. (19, 20, 39, 41).

Para a construção de pFMV53 e pFMV54, um fragmento SalI-StuI (nt 0 a 5377) de pH66 foi inserido nos locais SalI-SmaI de pNT120 (39), resultando em pFMV48. pFMV53 foi criado inserindo um fragmento SalI-XhoI de pF20CAT, contendo o promotor pregenômico FMV, no local SalI de pFMV48. A deleção subsequente do fragmento SacI resultou na nopalina sintase (NOS) terminador sendo colocado imediatamente a jusante do gene repórter CAT. pFMV54 foi criado por inserção de um fragmento SalI de pF20VIICAT, contendo FMV ORF VII precedido pelo promotor pregenômico FMV, no local SalI de pFMV48, seguido pela deleção do seu fragmento SacI. pFMV52 foi criado por inserção do fragmento SphI-NsiI de pH66 nos locais SphI-PstI de pNT120 (39) seguido pela deleção de seu fragmento SacI. A região VI do gene FMV usada para a construção de pFMV58, pFMV59 e pFMV60 foi derivada de um clone em que um local NdeI foi criado no códon de iniciação do gene VI ATG. o O fragmento NdeI-BamHI (nt 5361 a 7082) foi clonado em pJAW141 (41). Depois de ligação de um ligante SacI (CGAGCTCG) em seu sítio StuI, o SacI resultante fragmento foi clonado no sítio SacI de pFMV52, pFMV53 e pFMV54, resultando nos plasmídeos pFMV58, pFMV59 e pFMV60, respectivamente. As deleções na região do gene VI de pFMV58 foram feitas com o plasmídeo pFMV-RVI. Locais de restrição presentes nas posições indicadas. As restrições foram convertidas em locais SacI por tratamento com T4 DNA polimerase ou fragmento de Klenow seguido pela ligação de Ligantes SacI (CGAGCTCG) nos sites liberados. Os fragmentos SacI resultantes foram clonados no local SacI de pFMV52. Assim, em todos os casos, o gene VI segmentos seguidos pelo terminador NOS. pFMV63 foi derivado de pFMV60 por deleção de seu fragmento SalI contendo o promotor pregenômico FMV e gene VII. A fim de criar pFMV-C65, um ligante XhoI (CCTCGAGG) foi inserido no local EcoRI de pGS1 (19) após ter sido tratado com Klenow fragmento, resultando em pCaMV61. Os locais HindIII e PstI de pCaMV61 eram fundido por tratamento com T4 DNA polimerase seguido de auto-ligação. o O fragmento XhoI-SalI resultante contendo o promotor pregenômico CaMV foi clonado no local SalI de pFMV63, criando pFMV-C65. Exclusão subsequente de um fragmento SacI criado pFMV-C66. pCaMV67 foi criado pela substituição de o fragmento SalI-SacI de pFMV-C66 com um fragmento XhoI-SacI contendo o Gene repórter CAT de pBS-CAT (32). O plasmídeo pFMV86 foi criado por deleção de um fragmento NsiI (nt 3424 a 6599) de pH66. Exclusão de um PstI-NsiI (nt 1560 a 6599), AflII-NsiI (nt 1029 a 6599) ou ClaI-NsiI (nt 461 a 6599) fragmento de pH61 resultou, respectivamente, nos plasmídeos pFMV120, pFMV121 e pFMV122. A fim de criar pFMV88 e pFMV89, um PstI ligante (GCTGCAGC) foi inserido no sítio EcoRI de pNT120 (39) após havia sido embotado com fragmento de Klenow. O terminador NOS (que agora era delimitado por locais PstI) foi colocado como um fragmento PstI no local NsiI de pH61DN. A orientação do terminador NOS é tal que termina a transcrição em pFMV88, enquanto em pFMV89, a transcrição continua através do terminador NOS anti-sentido até atingir o terminador FMV nativo. Em ordem para criar pFMV91 e pFMV92, ambos o EcoRI (após embotamento com Klenow fragmento) e locais SmaI de pNT120 (39) foram convertidos em locais ClaI por inserção de um ligante ClaI (CATCGATG). Substituição do fragmento ClaI de pH61DN com o terminador NOS delimitado por ClaI resultou em pFMV91, no qual o terminador NOS bloqueia a transcrição em um ponto a cerca de 447 nt do início do gene I e pFMV92, no qual a orientação antisense do terminador NOS permite que a transcrição prossiga até que o terminador FMV nativo seja alcançado.

Exceto para o primeiro 74 nt, a região líder FMV incluindo

O ORF VII não é necessário para a expressão policistrônica.Seis do

sete ORFs principais presentes no genoma FMV e CaMV têm funções atribuídas (44). A única ORF à qual nenhuma função foi atribuída ainda é a ORF VII, e uma busca por sua FIG. 1. Organização genética do genoma FMV. A circular de 7.743 bp

O genoma de dsDNA de FMV é indicado por um anel cinza sombreado. As caixas tracejadas neste anel representam os promotores de RNA sub e pré-genômicos. As posições das principais ORFs são representadas por setas dentro do anel. Os dois RNAs principais 39coterminais transcritos do genoma FMV são indicados por setas periféricas. A inserção mostra a região 59leader do RNA pregenômico terminalmente redundante que contém uma série de pequenas ORFs e tem o potencial para formar uma estrutura secundária estável (indicada por linhas tracejadas).

Em 9 de novembro de 2019 por convidado

Http://jvi.asm.org/

produto de proteína durante uma infecção por CaMV não teve sucesso (48). No entanto, um elemento de ação cis localizado dentro do gene VII auxilia o processo pelo qual os ribossomos atravessam a grande e complexa região do líder FMV 59 (20). A fim de investigar se esse elemento era necessário para o mecanismo de expressão policistrônico do FMV, construímos uma série de plasmídeos contendo um repórter, um CAT ORF fundido na extremidade 39 do ORF III, que não possuía nenhuma das partes da região líder 59FMV, ORF VII, ou partes do ARN 39pregenômico (Fig. 2). Como controles para o processo de transativação, foram usados ​​pF20CAT, pF20VIICAT, pF32CAT e pH66 (19, 20, 41). A expressão do repórter CAT de pF20CAT, uma construção monocistrônica na qual o repórter CAT foi colocado imediatamente a jusante do promotor de RNA pré-genômico FMV, não foi responsiva à presença de P6 (Fig. 2). No entanto, a atividade CAT só pôde ser detectada quando os construtos bicistrônicos pF20VIICAT e pF32CAT, o último dos quais contém ORF VII precedido pela região líder FMV 59, foram expressos na presença de P6 (Fig. 2). Quando a ORF repórter CAT foi movida ainda mais a jusante para o RNA pregenômico FMV, a atividade CAT

não pôde mais ser resgatado pela coexpressão de P6 (Fig. 2, pFMV52). Como foi mostrado anteriormente por Scholthof et al. (42), a atividade CAT pode ser restaurada de uma maneira dependente de P6 após a 39 região proximal do RNA pré-genômico FMV ter sido adicionada (Fig. 2, pFMV58). Embora não tão marcada, uma restauração semelhante de P6-dependente da atividade de CAT pode ser obtida quando a região líder 59 foi excluída (Fig. 2, pFMV54). A adição do segmento de RNA proximal 39 proximal de FMV aumentou a atividade de CAT para níveis comparáveis ​​aos da construção de tipo selvagem, pH66 (Fig. 2, pFMV60). A deleção subsequente da ORF VII resultou em um padrão de atividade CAT semelhante, embora menos marcado (Fig. 2, pFMV53 e pFMV59).Isso indica que embora o elemento no gene VII estimule ligeiramente a expressão policistrônica, não é essencial para essa resposta.

Embora a maior parte da região líder seja deletada no plasmídeo pFMV53 (Fig. 2), um pequeno trecho de 74 nt do líder ainda está presente. Esta região líder foi retida no fragmento do promotor pré-genômico FMV porque parecia aumentar a eficiência do promotor FMV (18). Para examinar se isso FIGO. 2. Efeito dos elementos de ação cis e trans no genoma do FMV na expressão do RNA pré-genômico. Partes relevantes de plasmídeos usados ​​para eletroporação em Protoplastos de suspensão de células de N. edwardsonii são ilustrados, e locais de restrição indicativos e suas posições são dados. O gene repórter CAT é indicado por um leve caixa sombreada. As linhas pontilhadas representam regiões que foram deletadas de pH66. O promotor pré-genômico FMV é mostrado por uma caixa sombreada escura. O local de início da transcrição é indicado por uma seta. O terminador rubisco e o terminador NOS são indicados por RT e NT, respectivamente. A expressão de CAT obtida a partir de extratos de protoplastos é dada como porcentagem de acetilação e foi determinada pelo cálculo das formas acetiladas e não acetiladas do cloranfenicol a partir de dois experimentos independentes (A e B). Vinte microgramas de DNA de pFMV-RVI foram adicionados à mistura de eletroporação para co-expressão da proteína VI do gene transativador (P6). O asterisco indica que a mistura de eletroporação continha apenas 10 mg de DNA de pF20GUS usado para padronizar as eficiências de eletroporação, todas as outras amostras contêm um total de 70 mg de DNA. nd, não determinado.

Em 9 de novembro de 2019 por convidado

Http://jvi.asm.org/

região também estava envolvida na expressão policistrônica, nós substituímos o promotor FMV, incluindo este fragmento de 74 nt, com o promotor CaMV 35S (Fig. 3, pFMV-C66). A região promotora CaMV incluiu as primeiras 27 bases da região CaMV 59 não traduzida. Nenhum códon AUG está localizado nesta região. Surpreendentemente, nenhuma expressão de CAT pôde ser obtida a partir do construto pFMV-C66 (Fig. 3). A funcionalidade do promotor CaMV foi verificada substituindo o cas-sette policistrônico CAT em pFMV-C66 por um único cistron CAT (Fig. 3,

pCaMV67). Transcrições derivadas de pFMV-C66 e

pCaMV67 tem 59 regiões não traduzidas comparáveis. Porque pCaMV67 pode induzir a expressão de uma grande quantidade de atividade CAT, a incapacidade de pFMV-C66 para dirigir a expressão CAT não pode ser atribuída a um defeito no promotor CaMV. A adição da região proximal do RNA 39 pré-genômico FMV que estimulou a expressão policistrônica não resultou em qualquer aumento da atividade de CAT (Fig. 3, compare pFMV-C66 com pFMV-C65). Assim, um elemento essencial para a expressão policistrônica está localizado no primeiro 74 nt da região líder FMV.

A expressão policistrônica é aumentada pela combinação

ação de doiselementos cis-atuantes localizados perto do 3*fim do FMV

RNA pré-genômico, elementos que se tornam essenciais na

presença do FMV 5*região líder.O segundo cistron de

um construto bicistrônico torna-se eficientemente expresso quando o transativador de tradução de caulimovírus é co-expresso (Fig. 2,

pF20VIICAT) (2, 19). No entanto, um CAT ORF localizado internamente em um vetor policistrônico baseado em FMV é apenas eficientemente expresso quando os transcritos são marcados com a região de RNA pregenômico FMV 39 e P6 é co-expresso (Fig. 2, pFMV58) (42). Neste estudo, a atividade CAT pode ser obtida a partir de construtos policistrônicos baseados em FMV que carecem deste 39 elemento cis quando a região líder FMV também foi excluída (Fig. 2, pFMV54). Assim, parecia provável que a região 59leader funcionasse como um regulador negativo da expressão policistrônica, uma ação que é neutralizada pela 39elemento cis. No entanto, o ação deste 39elemento de ação cis não depende do presença da região líder 59, uma vez que descobrimos que a inserção deste elemento nos construtos pFMV54 e pFMV53 (que não possuem, respectivamente, a região líder FMV 59 e a região líder mais ORF VII) resultou em um aumento substancial na expressão policistrônica (Fig. 2 , pFMV59 e pFMV60).

A fim de definir melhor a natureza deste 39cis-elemento nós mapeou sua localização com mais precisão. Deleções aninhadas foram feitas nos terminais 59 e 39 do fragmento de 1.706 pb (abrangendo o gene VI) no qual estava contido. A atividade CAT dirigida pelas construções resultantes foi avaliada por eletroporação desses DNAs, acompanhada por uma expressão de P6 vetor, em protoplastos de suspensão de células de N. edwardsonii. A eliminação de 405 bp da extremidade 39, que inclui o terminador de transcrição FMV, resultou em uma diminuição acentuada na atividade de CAT (Fig. 4). Após a exclusão do terminador FMV, a FIG. 3. Efeito do promotor e do primeiro 74 nt do RNA pregenômico FMV na expressão do gene policistrônico. Partes relevantes das construções usadas para a eletroporação em protoplastos de suspensão de células de N. edwardsonii são dados, e as atividades de CAT induzidas são mostradas conforme descrito na legenda da Fig. 2. O sombreado a caixa em pFMV-C65 e pFMV-C66 indica o promotor CaMV 35S.

Em 9 de novembro de 2019 por convidado

Http://jvi.asm.org/

sinais de poliadenilação foram fornecidos pelo terminador NOS. Valores aproximadamente semelhantes de atividade de CAT foram observados quando até 1.075 bp foi excluído da extremidade 39. Uma deleção subsequente de 401 bp aboliu quase toda a atividade CAT.

Quando 230 bp foi deletado do 59 final, a atividade da CAT diminuiu marginalmente, mas uma deleção subsequente de 401 pb reduziu drasticamente a atividade da CAT (Fig. 4). Isso sugere que um o elemento cis de ativação está localizado entre nt 5607 e 6008 em o RNA pregenômico FMV. Este elemento, no entanto, atinge plena atividade apenas na presença de um elemento a jusante localizado entre o terminal 39 do RNA pré-genômico e nt 6678. A presença de dois elementos de ação sinérgica foi verificada pela criação de um conjunto de construtos em que esses elementos foram excluídos ou combinado. A comparação entre pFMV72, contendo os primeiros 59631 bp, pFMV74, contendo os últimos 39 405 bp, e pFMV81, em que ambas as regiões são combinadas, mostra claramente que ambos os elementos são necessários para o aumento ideal da expressão policistrônica (Fig. 5).

Um negativoelemento cis para a expressão policistrônica está localizado

no 3*fim do gene I.Quando ORF VII está presente a jusante

da região líder FMV, os ribossomos são capazes de atingir um gene repórter CAT subsequente com a ajuda do transativador translacional P6 (Fig. 2, pF32CAT). Com a ajuda de P6, os ribossomos também são capazes de atingir uma ORF de CAT colocada internamente no RNA pré-genômico do FMV (Fig. 2, pFMV53 e pFMV54). No entanto, quando a região líder FMV, incluindo ORF VII, é colocada na extremidade 59 de um cassete repórter policistrônico, quase nenhuma atividade CAT é obtida, a menos que os dois 39 elementos cis-atuantes estão presentes no 3Extremidade 9 da construção repórter (Fig. 2, pFMV52 e pFMV58). Evidentemente, as ações do aparelho de tradução, resultando na travessia da região líder FMV, tradução de um RNA policistrônico ou tradução de um RNA policistrônico que é precedido pela região líder FMV, não são idênticas. Este fenômeno foi analisado em mais detalhes comparando diretamente construtos repórter policistrônicos baseados em FMV nos quais a ORF CAT foi colocada diretamente a jusante da ORF VII (baseada em pH61) ou fundida em estrutura com ORF III (baseada em pH66). Como já foi mostrado anteriormente por Scholthof et al. (41), a expressão de CAT de plasmídeos derivados de pH61 e pH66 foi eficiente apenas na presença de P6, seja derivado desses plasmídeos ou de um vetor de expressão de P6 coeletroporado. Poderia ser

esperava-se que a expressão de construtos baseados em pH66, mas não a de construtos baseados em pH61, dependeria dos dois 39 elementos cis-atuantes. No entanto, a deleção da região do gene VI de pH61 (pH61DN) mostrou que a expressão de CAT deste construto era dependente de 39elementos cis-atuantes semelhante ao de pH66 (Fig. 6, pFMV86). Isso indica que os dois 39 elementos de ação cis não são necessários para que os ribossomos alcançar o CAT ORF depois de atravessar a região líder FMV. Em vez disso, parece que a deleção da região do gene VI revela um elemento de ação negativa que impede a expressão de CAT. Para mapear este elemento provisório de ação negativa, uma série de construções de deleção baseadas em pH61 foram criadas. A inserção do terminador NOS a jusante do CAT ORF em pH61 mostrou que o elemento negativo não está correlacionado com o terminador FMV (Fig. 7, pFMV88 e pFMV89). Só depois que a maior parte da ORF I foi deletada a atividade de CAT foi observada novamente (Fig. 7, pFMV122). Isso coloca o elemento de ação negativa entre nt 461 e 1029 na fronteira das ORFs I e II (Fig. 7).

Os vírus desenvolveram mecanismos elaborados que lhes permitem expressar com eficiência suas informações genéticas, mantendo um tamanho mínimo do genoma. Esses mecanismos incluem o uso de múltiplos promotores, sequências que influenciam a eficiência de splicing, tradução independente de cap, scan-ning com vazamento e frameshifting ribossômico. Um novo mecanismo, que permite a expressão simultânea de múltiplas ORFs individuais a partir de um mRNA, é usado pelos caulimovírus. Baseia-se na ação combinada de uma tradução codificada por vírus proteína transativadora e um conjunto de elementos de RNA de ação cis. Discernimento neste mecanismo foi obtido pela primeira vez quando foi demonstrado que os construtos bicistrônicos artificiais poderiam ser expressos em ensaios de expressão transitória quando os sinais de caulimovírus apropriados estavam presentes (2, 19). Usando um CAT ORF fundido a diferentes cistrons virais, Scholthof et al. (41) mostraram que o RNA pré-genômico do FMV pode servir como um mensageiro policistrônico. A novidade desse mecanismo de expressão foi potencializada pela descoberta de que a expressão das ORFs no RNA policistrônico pregenômico do CaMV depende da capacidade dos ribossomos de se envolverem no processo de tradução na estrutura 59cap do mRNA (15). Isso indica que as ORFs estreitamente espaçadas arranjadas em tandem no RNA pré-genômico não são traduzidas por um mecanismo envolvendo a iniciação interna da tradução. Em vez disso, os ribossomos que iniciaram a tradução na estrutura cap 59 são guiados para as ORFs a jusante com a ajuda de um ativador de tradução codificado por vírus.

Os 5* região líder do RNA pré-genômico.Numa tentativa de

compreender melhor os elementos reguladores envolvidos na expressão do gene cauli-movirus, realizamos uma extensa análise dos elementos reguladores de ação cis presentes na fase pré-genômica RNA de FMV. A longa região líder não traduzida do RNA pregenômico de caulimovírus, que por modelagem de computador, pode ser dobrada em uma grande estrutura de haste-alça (11), é muito inibidora para a varredura de ribossomos (1, 12). A fim de permitir que os ribossomos atravessem a região líder FMV, pelo menos dois elementos são necessários: um elemento de ação cis localizado dentro do ORF O VII deve estar presente a jusante da região líder, e o produto proteico do gene VI deve ser expresso simultaneamente na célula (20). No entanto, a questão permaneceu sem solução se toda a região líder não traduzida é necessária para a expressão das ORFs acopladas no RNA pré-genômico do FMV. A exclusão da maior parte da região líder resultou em um grande aumento da transativabilidade de construtos repórter policistrônico baseados em FMV, indicando que esta região líder é FIGO. 4. Mapeamento de um elemento de ação cis no gene VI do FMV que estimula

expressão do RNA pré-genômico. Deleções foram feitas na região VI do gene FMV de pFMV58, e a expressão do gene repórter CAT foi medida após eletroporação dessas construções juntamente com DNA de pFMV-RVI em protoplastos de suspensão de células de N. edwardsonii. As enzimas de restrição usadas para criar as exclusões e suas posições são fornecidas.

Em 9 de novembro de 2019 por convidado

Http://jvi.asm.org/

não é necessário para a expressão policistrônica (Fig. 2, pFMV54). A deleção adicional de ORF VII não impediu a transativabilidade das construções repórter (Fig. 2, pFMV53). Assim, o elemento cis presente no gene VII não é essencial para ativação. Talvez ele atue aumentando a capacidade do transativador de direcionar a travessia da região líder pelos ribossomos ou aumentar a eficiência com a qual um complexo de tradução policistrônico é formado na extremidade 59 do mRNA. Embora a maior parte da região líder do RNA pré-genômico não fosse necessária para o mecanismo de tradução policistrônico, o líder inteiro não era dispensável. pFMV53 e pFMV54 ainda contêm uma pequena região líder de 74 nt 59 que está conectada ao promotor FMV (Fig. 3). A substituição do promotor FMV contendo esta região 59leader com o RNA pré-genômico CaMV aboliu completamente a expressão do gene repórter (Fig. 3, pFMV-C66). Esta região líder de RNA pregenômico de FMV 74-nt

contém um curto ORF que codifica o tripeptídeo Met-Arg-Gly, que é uma reminiscência do curto ORF mostrado para ser necessário no líder 59 do CaMV. Este curto ORF é necessário para expressar o segundo cistron de uma construção bicistrônica com o auxílio do transativador CaMV (14). Foi sugerido que os ribossomos que traduziram uma ORF curta estão em um estado potencialmente ativado, pois não perderam todos os fatores de iniciação da tradução ao atingir o códon de parada (29). Em contraste com os ribossomos procarióticos, os ribossomos eucarióticos que perderam os fatores de iniciação da tradução após o engajamento na tradução não são prontamente capazes de recuperá-los. Assim, os ribossomos eucarióticos que encontram um códon de parada após a tradução de uma ORF curta estão em um estado de competência de tradução aprimorada que lhes permite reiniciar a tradução de forma eficiente em uma ORF a jusante. De fato, quando a curta ORF presente a montante de um sistema repórter bicistrônico foi aumentada para FIGO. 5. Dois cis-elementos de ação sinérgica no FMV ORF VI estimulam a expressão do RNA pré-genômico. Partes relevantes de construções contendo deleções na região do gene VI de pFMV58 são mostradas como descrito na legenda da Fig. 2. As enzimas de restrição usadas para criar as deleções e suas posições são fornecidas. ORF VI termina em nt 6900. Expressão do gene repórter CAT medido após eletroporação dessas construções juntamente com DNA de pFMV-RVI em N. edwardsonii protoplastos de suspensão de células é indicado. Os níveis de atividade CAT obtidos com a construção pFMV58 sem coexpressão de P6 foram de 2% no experimento A e 1% no experimento B.

Em 9 de novembro de 2019 por convidado

Http://jvi.asm.org/

mais de 50 nt, a expressão do segundo gene repórter declinou dramaticamente (14). No entanto, porque este segundo gene re-porter só pode ser expresso com o auxílio do transativador de tradução CaMV, foi proposto que CaMV P6 estabiliza a competência de reinicialização de ribossomos após a tradução de uma ORF curta. Talvez P6 acelere a tradução de um mRNA policistrônico estabilizando ribossomos que alcançaram um estado de competência translacional aprimorada por meio da tradução de uma ORF curta. Isso, no entanto, não explica o necessidade do elemento cis da ORF VII para permitir a passagem do Região líder FMV 59. Para o CaMV, foi postulado um modelo que previa que o movimento do complexo P6 do ribossomo ativado através da região líder não era contínuo, mas envolvia um shunt ribossomal (15). Se adaptarmos este modelo para FMV, a ORF VII poderia funcionar de maneira semelhante à da ORF F curta do CaMV na formação do sítio aceptor de shunt. Isto pode ser responsável pelo ligeiro aumento na atividade CAT de pFMV54, que contém ORF VII, em comparação com a de pFMV53, que não possui ORF VII (Fig. 2). Como toda a região líder FMV incluindo ORF VII pode ser deletada sem impedir a capacidade de um RNA policistrônico ser traduzido na presença de P6, a região líder de RNA pré-genômico de caulimovírus não é essencial para a expressão do gene policistrônico, mas sim cumpre uma função reguladora . Em muitos retrovírus e pararetrovírus, os elementos reguladores envolvidos no equilíbrio da replicação e tradução são encontrados na região 59 dos RNAs virais (37).

Elementos do 3*região do RNA pré-genômico.The 39region

do RNA pré-genômico que engloba o gene VI é essencial para a expressão policistrônica de construtos repórter baseados em FMV (42). No entanto, quando toda a região 59leader foi deletada, a expressão policistrônica pode ser obtida sem este 39 cis-elemento (Fig. 2, pFMV53 e pFMV54). Um mais cuidadoso

anal-ysis revelou que existem, na verdade, dois elementos cis-atuantes localizado na região do gene VI do RNA pré-genômico do FMV (Fig. 4 e 5). Ambos os elementos eram necessários para a expressão de construtos repórter policistrônicos na presença da região líder FMV 59. Na ausência da região líder 59, eles aumentaram a expressão policistrônica substancialmente (Fig. 2, pFMV59 e pFMV60). Surpreendentemente, pelo menos o mais a montante desses dois elementos também era necessário para a expressão de uma ORF repórter CAT colocada imediatamente a jusante da ORF VII em um vetor de expressão FMV quase de comprimento total (Fig. 6). Isto foi inesperado, porque um repórter ORF colocado na mesma posição, mas sem quaisquer sequências FMV a jusante, foi eficazmente expresso com o auxílio de P6 (Fig. 2, pF32CAT). Assim, a necessidade das sequências de ação cis do gene VI em um O construto repórter policistrônico baseado em FMV surge tanto da região 59leader quanto de elementos a jusante.

Embora não tenhamos sido capazes de apoiar nossos estudos de expressão transiente com análises Northern devido a problemas na obtenção de RNA suficiente de protoplastos eletroporados, os dados suportam um modelo no qual dois elementos são necessários para expressão policistrônica: isto é, uma pequena ORF é necessária em cis a montante dos cistrons acoplados e um fator de ação trans, o Produto proteico ORF VI, deve ser expresso simultaneamente na célula. O processo de expressão policistrônico é estimulado pela presença combinada de dois 39elementos cis-atuantes. Contudo, a região do mRNA 39pregenômico também está presente no RNA subgenômico do FMV. Curiosamente, a mesma região que aumenta a expressão policistrônica reduz a expressão dos mRNAs monocistrônicos que a contêm, um efeito anulado pelo transativador de tradução P6 (42). Pode-se especular que os elementos 39 atuam para realocar os mRNAs do FMV para locais citoplasmáticos com eficiência translacional reduzida. Os mesmos 39 elementos poderiam, no entanto, também concentrar P6 em torno da FIG. 6. Comparação dos níveis de expressão do primeiro e terceiro cistrons do RNA pré-genômico do FMV.Partes relevantes dos construtos usados ​​para eletroporação em protoplastos de suspensão de células N. edwardsonii são ilustrados, e as atividades de CAT que eles induziram são dadas conforme descrito na legenda da Fig. 2. Em pH66, o CAT A ORF é fundida na estrutura na extremidade 39 da ORF III, enquanto em pH61, a ORF de CAT é colocada entre as ORFs VII e I.

Em 9 de novembro de 2019 por convidado

Http://jvi.asm.org/

os mRNAs de caulimovírus, análogos a uma das funções propostas para a cauda poli (A) na atração de fatores de iniciação da tradução para um mRNA (16). A este respeito, é digno de nota que P6 demonstrou ter atividade de ligação de RNA de fita simples (7, 8) e que um domínio de RNase H eucariótica com semelhança a P6 tem atividade de ligação de dsRNA (4, 34). A interação entre o P6, produzido inicialmente em pequenas quantidades neste domínio citoplasmático, com os ribossomos (7) e os RNAs de caulimovírus poderia subsequentemente resultar na tradução específica do RNA de caulimovírus. Curiosamente, o transativador de tradução de caulimovírus de linha clorótica de amendoim (PClSV) aumenta especificamente a expressão de construtos policistrônicos contendo Sinais de ação cis do PClSV, sugerindo uma interação direta entre os elementos de ação cis e P6 (9). Alternativamente, estes 39 elementos podem interagir com outros fatores para regular a tradução muito parecido com o encontrado em uma variedade de outros sistemas, por exemplo, tradução de mRNA de interferon beta (31), Cenorhabditis el-egans tra-2 mRNA (17), Trypanosoma brucei procyclin mRNA (21), RNA do vírus da necrose do tabaco satélite (6, 46) ou RNA do luteovírus (47).

Uma ação negativa cis-elemento está localizado internamente em

RNA pré-genômico. A regulação do mRNA de caulimovírus aumentou em

complexidade com a identificação de uma ação negativa cis-elemento localizado na fronteira entre a ORF I e a ORF II (Fig.

7). Para plena atividade, este elemento depende da presença da região líder do FMV 59. pFMV54 expressou atividade CAT na presença de P6, mas pFMV88 não. A ação deste elemento foi neutralizada pela dos 39elementos cis-atuantes (Fig. 7, compare pH61DS, pH61DN e pFMV122). A função desse elemento no ciclo de vida do FMV ainda está aberta para especulação. Como todos os retrovírus e pararetrovírus, os caulimovírus têm um ciclo de replicação complexo que inclui as fases nu-clear e citoplasmática. Os pararetrovírus transcrevem seu genoma em um RNA pré-genômico no núcleo, após o qual é transportado para o citoplasma, onde é transcrito reversamente em um genoma de DNA. Este modo de replicação depende da capacidade de uma grande molécula de RNA pré-genômico de escapar do processo de splicing nuclear, um processo que nos eucariotos é conhecido por estar intimamente ligado à exportação nuclear, com transcritos não duplicados sendo degradados em vez de exportados (10, 25). Tanto em retrovírus quanto no vírus da hepatite B, foram descritos sinais de RNA que auxiliam o vírus neste processo (3, 5, 23, 24). Portanto, não é improvável que os caulimovírus contenham sinais semelhantes. Que os RNAs do movírus cauli interagem com a maquinaria de splicing nuclear é ilustrado pelo fato de que mutantes de deleção foram encontrados nos quais as sequências deletadas são delimitadas por sítios de splice de mRNA de consenso (22, 40). Uma interação entre o RNA pré-genômico de CaMV e o aparelho de splicing nuclear FIG. 7. Identificação de um elemento no RNA pré-genômico do FMV que regula negativamente a expressão do gene I. Partes relevantes dos construtos usados ​​para eletroporação em protoplastos de suspensão de células de N. edwardsonii são mostradas, e a atividade de CAT induzida por eles é dada conforme descrito na legenda da Fig. 2. O NOS terminador é indicado por NT. Quando o NT está presente em uma orientação reversa não funcional, ele é indicado por ser colocado de cabeça para baixo.

Em 9 de novembro de 2019 por convidado

Http://jvi.asm.org/

foi recentemente comprovado por Kiss-La´szlo´ et al. (28). Como o FMV requer P6 para a expressão de cada uma das ORFs presentes em seu RNA pré-genômico, foi especulado que P6 não só funciona na transativação translacional, mas também auxilia no transporte citoplasmático nuclear (39). Parece provável que exista uma interação dinâmica entre as sequências regulatórias de RNA e P6, cada uma participando individualmente ou em combinação umas com as outras em várias etapas do ciclo de vida do caulimovírus.

Agradecemos a Indu Maiti pelo presente de pBS-CAT. Agradecemos Katja Richert-Poeggeler, Neil Weitzmann e Huei-Fung Tsai pela leitura crítica do manuscrito. Arcady Mushegian é agradecida por seus sábios conselhos.

H.K.E. recebeu uma bolsa Philip Morris Fellowship. Esta pesquisa foi apoiada em parte pela bolsa do NIH KTBR 5-41043 / 86.

1. Baughman, G. e S. H. Howell. 1988. Cauliflower mosaic virus 35S RNA a região líder inibe a tradução de genes a jusante. Virology 167: 125– 135.

2. Bonneville, J. M., H. Sanfac¸on, J. Fuëtterer e T. Hohn.1989. Transativação pós-transcricional no vírus do mosaico da couve-flor. Cell 59: 1135–1143. 3. Brighty, D. W. e M. Rosenberg. 1994. Uma sequência repressiva de ação cis

que se sobrepõe ao elemento responsivo a Rev do vírus da imunodeficiência humana tipo 1 regula a retenção nuclear de mRNAs de env independentemente de sinais de emenda. Proc. Natl. Acad. Sci. USA 91: 8314–8318.

4. Cerritelli, S. M. e R. J. Crouch. 1995. O domínio não-RNase H de Saccharomyces cerevisiae RNase H1 se liga a RNA de fita dupla: magnésio modula a mudança entre a ligação de RNA de fita dupla e Atividade de RNase H. RNA 1: 246-259.

5. Cullen, B. R. e M. H. Malim. 1991. The HIV-1 Rev protein: prototype of uma nova classe de reguladores pós-transcricionais eucarióticos. Trends Biochem. Sci. 16: 346–350.

6. Danthinne, X., J. Seurinck, F. Meulewaeter, M. Van Montagu e M. Cornelissen.1993. A 39 região não traduzida da necrose satélite do tabaco o RNA do vírus estimula a tradução in vitro. Mol. Célula. Biol. 13: 3340–3349. 7. De Tapia, M., A. Himmelbach e T. Hohn. 1993. Dissecção molecular de

o transativador translacional do vírus do mosaico da couve-flor. EMBO J. 12: 3305– 3314.

8. Edskes, H. K. 1994. Ph.D. tese. Universidade de Kentucky, Lexington. 9. Edskes, H. K., J. M. Kiernan e R. J. Shepherd. 1996. Tradução eficiente

de cistrons distais de um mRNA policistrônico de um pararetrovírus vegetal requer uma interação compatível entre o mRNA 39end e o proteináceo transativadores. Virology 224: 564-567.

10. Elliott, D. J., F. Stutz, A. Lescure e M. Rosbash. 1994. mRNA nuclear exportar. Curr. Opiniões Genet. Dev. 4: 305–309.

11. Fuëtterer, J., K. Gordon, J. M. Bonneville, H. Sanfac¸on, B. Pisan, J. Pen-swick e T. Hohn.1988. A sequência principal do grande RNA de caulimovírus pode ser dobrado em uma grande estrutura de haste-laço. Nucleic Acids Res. 16: 8377- 8390.

12. Fuëtterer, J., K. Gordon, H. Sanfac¸on, J.-M. Bonneville e T. Hohn.1990. Controle positivo e negativo da tradução pela sequência líder de cau-liflower mosaic virus pregenomic 35S RNA. EMBO J. 9: 1697-1707. 13. Fuëtterer, J. e T. Hohn.1991. Tradução de um mRNA policistrônico no

presença da proteína transativadora do vírus do mosaico da couve-flor. EMBO J. 10:3887–3896.

14. Fuëtterer, J. e T. Hohn.1992. Role of a upstream open reading frame in the translation of polycistronic mRNAs in plant cells. Nucleic Acids Res. 20:3851–3857.

15. Fuëtterer, J., Z. Kiss-La´szlo´ e T. Hohn.1993. Ribossomo não linear migração no RNA 35S do vírus do mosaico da couve-flor. Cell 73: 789–802.

16. Gallie, D. R. e R. Tanguay. 1994. Poly (A) se liga a fatores de iniciação e aumenta a tradução dependente de cap in vitro. J. Biol. Chem. 269: 17166–17173. 17. Goodwin, E. B., P. G. Okkema, T. C. Evans e J. Kimble. 1993. A regulação translacional de tra-2 por sua região não traduzida controla a identidade sexual em C. elegans. Cell 75: 329–339.

18. Gowda, S. 1991. Comunicação pessoal.

19. Gowda, S., F. C. Wu, H. B. Scholthof e R. J. Shepherd. 1989. Gene VI of O vírus do mosaico da figueira (grupo caulimovírus) atua na expressão pós-transcricional de genes no transcrito de RNA de comprimento total. Proc. Natl. Acad. Sci. USA 86: 9203–9207.

20. Gowda, S., H. B. Scholthof, F. C. Wu e R. J. Shepherd. 1991. Requerimento do gene VII em cis para a expressão de genes a jusante no principal transcrição do vírus do mosaico da figueira. Virology 185: 867–871.

21. Hehl, A., E. Vassella, R. Braun e I. Roditi. 1994. Um laço de haste conservado estrutura na 39 região não traduzida de mRNAs de prociclina regula expressão em Trypanosoma brucei. Proc. Natl. Acad. Sci. USA 91: 370–374. 22. Hirochika, H., H. Takatsuji, A. Ubasawa e J.-E. Ikeda. 1985. Site-specific

deleção no DNA do vírus do mosaico da couve-flor: possível envolvimento do RNA splicing e transcrição reversa. EMBO J. 5: 2759–2762.

23. Huang, J. e T. J. Liang. 1993. Um romance genético do vírus da hepatite B (HBV) elemento com propriedades semelhantes a um elemento de resposta de Rev que é essencial para expressão de produtos do gene HBV. Mol. Célula. Biol. 13: 7476–7486.

24. Huang, Z.-M. e T. S. B. Yen. 1995. Papel do vírus da hepatite B elemento regulador pós-transcricional na exportação de transcritos sem íntron. Mol. Célula. Biol. 15: 3864–3869.

25. Izaurralde, E. e I. W. Mattaj. 1992. Transporte de RNA entre o núcleo e citoplasma. Semin. Cell Biol. 3: 279–288.

26. Jefferson, R. A., T. A. Kavanagh e M. W. Bevan. 1987. fusão GUS:

b-glucuronidase como um marcador de fusão de genes sensível e versátil em plantas. EMBO J. 6: 3901–3907.

27. Kiernan, J. M., F. C. Wu, K.-B. Goldberg, S. Gowda e R. J. Shepherd. 1993. Transformation in Nicotiana edwardsonii, p. 294–307. Em Y. P. S. Bajaj (ed.), Plant protoplasts and genetic engineering III. Springer-Verlag, Berlim, Alemanha.

28. Kiss-La´szlo´, Z., S. Blanc e T. Hohn.1995. Splicing of cauliflower mosaic O RNA do vírus 35S é essencial para a infecciosidade viral. EMBO J. 14: 3552–3562. 29. Kozak, M. 1987. Effects of intercistronic length on thefficiency of

reinicialização por ribossomos eucarióticos. Mol. Célula. Biol. 7: 3438–3445.

30. Kozak, M. 1992. Regulation of translation in ekaryotic systems. Annu. Rev. Cell Biol. 8: 197–225.

31. Kruys, V., M. Wathelet, P. Poupart, R. Contreras, W. Fiers, J. Content, e G. Huez.1987. The 39untranslated region of the human interferon-bmRNA tem um efeito inibitório na tradução. Proc. Natl. Acad. Sci. EUA 84: 6030– 6034.

32. Maiti, I. B. Dados não publicados.

33. Meagher, R. B., R. J. Shepherd e H. W. Boyer. 1977. A estrutura de vírus do mosaico da couve-flor. I. Um mapa de endonuclease de restrição de couve-flor DNA do vírus do mosaico. Virology 80: 362–375.

34. Mushegian, A. R., H. K. Edskes e E. V. Koonin. 1994. Eukaryotic RNAse H compartilha um domínio conservado com proteínas de caulimovírus que facilitam tradução de RNA policistrônico. Nucleic Acids Res. 22: 4163–4166.

35. Olszewski, N., G. Hagen e T. J. Guilfoyle. 1982. Um transcricionalmente ativo, Minicromossomo covalentemente fechado de DNA do vírus do mosaico da couve-flor isolado de folhas de nabo infectadas. Cell 29: 395–402.

36. Richins, R. D., H. B. Scholthof e R. J. Shepherd. 1987. Sequence of DNA do vírus do mosaico da figueira (grupo caulimovírus). Nucleic Acids Res. 15: 8451–8466.

37. Rothnie, H. M., Y. Chapdelaine e T. Hohn. 1994. Pararetrovírus e retrovírus: uma revisão comparativa da estrutura viral e expressão gênica estratégias. Adv. Virus Res. 44: 1–67.

38. Sambrook, J., E. F. Fritsch e T. Maniatis. 1989. Molecular cloning: a manual de laboratório, 2ª ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

39. Scholthof, H. B. 1990. Ph.D. tese. Universidade de Kentucky, Lexington. 40. Scholthof, H. B., F. C. Wu, R. D. Richins e R. J. Shepherd. 1991. A

mutante de deleção de ocorrência natural do vírus do mosaico da figueira (caulimovírus) é gerado por splicing de RNA. Virology 184: 290–298.

41. Scholthof, H. B., S. Gowda, F. C. Wu e R. J. Shepherd. 1992. O transcrição completa de um caulimovírus é um mRNA policistrônico cujos genes são transativados pelo produto do gene VI. J. Virol. 66: 3131–3139. 42. Scholthof, H. B., F. C. Wu, S. Gowda e R. J. Shepherd. 1992. Regulamento

da expressão gênica de caulimovírus e o envolvimento de elementos cis-atuantes em ambas as transcrições virais. Virology 190: 403–412.

43. Shepherd, R. J., R. J. Wakeman e R. R. Romanko. 1968. DNA em vírus do mosaico da flor de couve. Virology 36: 150–152.

44. Shepherd, R. J. 1989. Biochemistry of DNA plant virus, p. 563–616. Em um. Marcus (ed.), The biohemistry of plants. Academic Press, Inc., New York, N.Y.

45. Temin, H. M. 1985. Transcrição reversa no genoma eucariótico: retro-vírus, pararetroretro-vírus, retrotransposons e retrotranscritos. Mol. Biol. Evol. 2: 455–468.

46. ​​Timmer, R. T., L. A. Benkowski, D. Schodin, S. R. Lax, A. M. Metz, J. M. Ravel e K. S. Browning.1993. As 59 e 39 regiões não traduzidas do RNA do vírus da necrose do tabaco por satélite afetam a eficiência da tradução e a dependência de um 59estrutura da tampa. J. Biol. Chem. 268: 9504–9510.

47. Wang, S. e W. A. ​​Miller. 1995. Uma sequência localizada 4,5 a 5 quilobases de a extremidade 59 do genoma do vírus da anã amarela da cevada (PAV) estimula fortemente tradução de mRNA sem limite. J. Biol. Chem. 270: 13446–13452. 48. Wurch, T., D. Kirchherr, J.-M. Mesnard e G. Lebeurier. 1990. O

O produto do quadro de leitura aberta VII do vírus do mosaico da couve-flor pode ser expresso em Saccharomyces cerevisiae, mas não é detectado em plantas infectadas. J. Virol.


Exame de genética 4

Vetores são plasmídeos bacterianos - eles são modificados para clonagem. As características básicas de todos eles é que eles podem se replicar (origem de replicação), genes resistentes a antibióticos (então você pode introduzi-los sem que as células de DNA o reconheçam) e deve haver lugares ao redor do plasmídeo onde as enzimas de restrição cortam apenas uma vez, e apenas uma vez. Você quer que seja aberto para que possa aceitar uma inserção, e os plasmídeos foram modificados onde os sites cortam apenas uma vez.

2. Corte o DNA com enzimas de restrição

3. Insira fragmentos de DNA em um & quotVetor & quot (plasmídeo)

4. Introduzir DNA recombinante na célula hospedeira E. coli)

5. Cada colônia bacteriana contém um único clone de DNA recombinante
* A enzima de restrição usada para genomas inteiros é YAC

O RNA e o DNA juntos agora, e o RNA H degrada o RNA e só degrada o RNA que está ligado ao DNA. Você adiciona isso para retirar o RNA, mas não todo, e então adiciona DNA poli 1 e ele preencherá os espaços e usará o primer para cortar e cortar o RNA e substituí-lo por DNA.
Adicione DNA ligase & amp seal, agora você tem um pedaço de DNA que corresponde a um mensageiro. Para entrar em um plasmídeo, você deve manipular mais etapas (não precisa saber)

Basta saber a transcriptase reversa e a enzima Rnase H

sequências curtas (2-50 bases de comprimento)
várias cópias em muitos sites diferentes
os indivíduos variam no número de cópias
2-100 cópias por site em

- Metade do aumento deve-se a melhorias nas práticas agrícolas, metade ao melhoramento de plantas

-Resistência a herbicidas - cultivar plantas sem produtos químicos não é realista para sustentar toda a nossa população - pulverizar com compostos sintetizados organicamente é sempre um risco, este composto em particular é o menos tóxico que conhecemos, mas não completamente atóxico, isso mata todas as plantas ao bloquear o EPSP, que bloqueia a síntese de aminoácidos (todos os animais obtêm aminoácidos da dieta) o glifosato tem baixa toxicidade para todos os animais e se degrada rapidamente no solo
-FDA colocou isso na lista de carcinógenos ASSIM que tem o potencial de causar câncer, mas não é conhecido por causar câncer, apenas as pessoas em risco são as pessoas que fazem ou usam este composto

O processo de produção de uma cópia de DNA a partir de uma molécula de RNA é denominado transcrição reversa. É realizada por uma das enzimas carregadas no vírus, chamada transcriptase reversa. Depois que essa cópia de DNA é produzida e fica livre no núcleo da célula hospedeira, ela deve ser incorporada ao genoma da célula hospedeira. Ou seja, deve ser inserido nas grandes moléculas de DNA da célula (os cromossomos). Esse processo é feito por outra enzima carregada no vírus chamada integrase (veja a figura 2).

Agora que o material genético do vírus foi incorporado e passou a fazer parte do material genético da célula hospedeira, podemos dizer que a célula hospedeira foi modificada para conter um novo gene. Se essa célula hospedeira se dividir posteriormente, todos os seus descendentes conterão os novos genes. Às vezes, os genes do retrovírus não expressam suas informações imediatamente.

Os vetores retrovirais são criados pela remoção dos genes retrovirais gag, pol e env. Estes são substituídos pelo gene terapêutico. Para produzir partículas de vetor, uma célula de empacotamento é essencial. As linhas de células de empacotamento fornecem todas as proteínas virais necessárias para a produção do capsídeo e a maturação do vírion do vetor. Essas linhas de células de empacotamento foram feitas de modo que contenham os genes gag, pol e env. As primeiras linhas de células de empacotamento continham genomas retrovirais competentes para replicação e um único evento de recombinação entre este genoma e o vetor de DNA retroviral poderia resultar na produção de um vírus de tipo selvagem. Após a inserção do gene desejado no vetor de DNA retroviral e a manutenção da linha de células de empacotamento adequada, agora é uma questão simples preparar vetores retrovirais (ver figura 3).


Materiais e métodos

Declaração de ética

A administração intratraqueal de vetores virais foi realizada sob anestesia com 2,2,2 Tribromoetanol e todos os esforços foram feitos para minimizar o sofrimento. Todos os experimentos com camundongos foram realizados em estrita conformidade com as recomendações do Canadian Council on Animal Care (CCAC) “Guia para o cuidado e uso de animais experimentais”E de acordo com as condições e procedimentos aprovados pelo Animal Care Committee da McGill University (número AUP: 5819).

Geração de vetores de plasmídeo

Plasmídeos de entrada.

Todos os vetores de plasmídeo foram produzidos usando técnicas de clonagem padrão. Uma descrição mais exaustiva dos protocolos usados, histórico de construção e sequência de plasmídeo estão disponíveis mediante solicitação. Todos os plasmídeos aqui descritos serão disponibilizados através da Addgene (www.addgene.org). Os genes flanqueados por AttL1-attL2 foram clonados em plasmídeos pENTR-D TOPO de produtos de PCR ou em pENTR1 usando métodos baseados em enzimas de restrição padrão.O DNA contendo os locais attR2-attL3 ou attR3-attL4 separados por uma região de multi-clonagem foi sintetizado por BioBasic e usado para produzir dois plasmídeos de entrada resistentes à canamicina derivados de pOK1 / 2 [22], pBEG R2-L3 e pBEG R3-L4. A região de multi-clonagem que separa os locais attX continha a sequência GGGCCGGCGCGGCCGCACGCGTGCTGAGGAGACATCTAGACTTTCCCTCAGCGTCGACGATATCGGCGCGCCCCCGGG. pBEG R2-i * X-R3 contendo o "forte" (IRES * [23]) foi produzido clonando o cassete IRES de pQXIN IRES * (um presente de Daniel Gray UCSF) para os sites RE3-RE4 de pBEG R2-L3. pBEG R2-IRESX-R3, que contém o IRES "fraco", foi clonado a partir de um derivado de pQCXiX contendo um marcador de resistência à puromicina (gene N-acetil-transferase) para criar pBEG R2-iPuro-L3. Genes de resistência a drogas que conferem neomicina, blasticidina-S (blasticidina-S desaminase) e higromicina-B (higromicina fosfotransferase) foram excisados ​​de plasmídeos derivados de pQCxix e clonados entre os locais BglII / EcoRV de pBEG R2-iPuro-L3.

Um cassete de miRNA-30 foi sintetizado por BioBasic e clonado nos locais NotI / EcoRV de pBEG R3-L4 para criar pBEG R3-miRNA (X) -L4. Em seguida, um cassete de cloranfenicol-ccdB flanqueado por EcoRI / XhoI foi clonado nos locais EcoRI / XhoI do cassete miRNA-30 criando pBEG R3-miRNA (ccdB) -L4, o que simplifica muito a clonagem de novos shRNAs flanqueados por EcoRI / XhoI.

Plasmídeos de destino viral.

A síntese de um único fragmento contendo locais attR1-attR4 em tandem foi repetidamente malsucedida. Assim, sintetizamos locais attR1 e attR4 individuais e os clonamos em pOK1 / 2 de modo que fossem separados por um marcador de resistência ao cloranfenicol para produzir pBEG R1-ChlorR-R4. O cassete de seleção de cloranfenicol foi amplificado por PCR a partir de um vetor de destino de gateway de laboratório (gQxiPuro, plasmídeo não publicado) usando os seguintes primers direto (5′-CACC TCTAGA CTCGAGATTAGGCACCCCAGGCTTTACAC) e reverso (5′-ATATGAATTCGTCGACCTGCAGACTGGCTGTG) e clonado no local XbaI de pOK1 / 2 B [22] dando pOK1 / 2 B (ClorR). Em seguida, o site attR1 de fragmento A de pUC57 foi clonado neste vetor usando BglII / NotI dando pBEG R1-ChlorR-R4.

Para criar o vetor de destino de três vias (attR1-attR3), o local attR4 foi substituído por attR3 de pBEG R3-L4 que foi cortado com NheI / NgoMIV e clonado no local SpeI / XmaI de pBEG R1-ChlorR-R4 criando pBEG R1-ChlorR-R3. finalmente, o ccdB-CloroR cassete de gQxiPuro foi clonado em ambos pBEG R1-CloroR-R3 e pBEG R1-CloroR-R4 vetores com NotI / SalI. Uma vez que os cassetes R1-R4 e R1-R3 Gateway existiam como plasmídeos pBEG, foi possível produzir os vetores de destino pLEG e pREG. Para este fim, os cassetes R1 – R3 / R4 foram excisados ​​com BglII / HpaI e clonados em pLEXiPuro (Open Biosystems) em locais BamHI / HpaI e com SacII / HpaI em gQxiPuro em locais SacII / EcoRV. Assim, os seguintes quatro vetores de destino foram produzidos: dois vetores lentivirais pLEG (R1 – R3) e pLEG (R1 – R4) e dois vetores retrovirais pREG (R1 – R3) e pREG (R1 – R4).

Todos os vetores de destino viral produzidos por este sistema usam um LTR 3 ′ auto-inativador (SIN) que contém uma deleção na região U3, tornando o LTR transcricionalmente inativo. Esta deleção é copiada para o 5 ′ LTR durante a transcrição reversa, evitando a replicação viral adicional e reduzindo muito a probabilidade de a inserção viral ativar oncogenes endógenos [24], [25].

Plasmídeo repórter de luciferase.

Um plasmídeo repórter de luciferase dual de destino separado, pCheck2 Dest (R1-R2), foi criado por clonagem de extremidade cega de um cassete de destino attR1-attR2 (Invitrogen) no local NotI (embotado usando Klenow) de pSiP1 [26].

Projeto de miRNA-shRNA Plasmídeos. Todo miRNA foi produzido por PCR usando um oligonucleotídeo ∼100 bp "molde shRNA" e amplificado com primers universais. O iniciador universal 5 ′ (5′-CACCCTCGAGAAGGTATAT TGCTGTTGACAGTGAG) e iniciador universal 3 ′ (5′-CCCCTTGAATTC CGAGGCAGTAGGCA) foram baseados nos usados ​​por Hannon et al. [11]. Os PCRs foram realizados usando 0,5 unidades de polimerase Phusion, 200 nM dNTP, 400 nM de cada iniciador, 400 nM molde, 704 nM DMSO com 30 ciclos (10 seg 98 ° C, 30 seg 60 ° C, 60 seg 72 ° C).

Fragmentos de shRNA amplificados por PCR foram clonados entre os locais XhoI e EcoRI (em itálico nos primers universais) do cassete de miRNA. O oligonucleotídeo modelo shRNA deve ter uma sobreposição correspondente com os primers universais (sublinhados e em verde) como mostrado: modelo central shRNA = TGCTGTTGACAGTGAG CGUMA(Sequência shRNA)C TGCCTACTGCCTCG (os nucleotídeos em negrito podem variar, mas não podem se complementar, ver [11], [27]). Estruturas de shRNA são baseadas em sequências publicadas [28] todas tendo uma sequência de loop de 19 pb constante (X -TAGTGAAGCCACAGATGTA-X ’) flanqueada por sequências 19-23 nt (X e X’) homólogas ao alvo (sublinhado duplo).

ShRNAs específicos de p53 de camundongo:

HP65: TGCTGTTGACAGTGAG CGCCCACTACAAGTACATGTGTAATAGTGAAGCCACAGATGTATTACACATGTACTTGTAGTGGUMA TGCCTACTGCCTCGGA

HP44: TGCTGTTGACAGTGAG CGCGGAAATTTGTATCCCGAGTATTAGTGAAGCCACAGATGTAATACTCGGGATACAAATTTCCT TGCCTACTGCCTCGGA

HP18: TGCTGTTGACAGTGAG CGUMACCAGTCTACTTCCCGCCATAATAGTGAAGCCACAGATGTATTATGGCGGGAAGTAGACTGGC TGCCTACTGCCTCGGA

ShRNAs específicos de GFP ou dsRed:

GFP01: TGCTGTTGACAGTGAG CGUMAGCACAAGCTGGAGTACAACTATAGTGAAGCCACAGATGTATAGTTGTACTCCAGCTTGTGCC TGCCTACTGCCTCGGA

dsRed01: TGCTGTTGACAGTGAG CGCAACGAGGACTACACCATCGTTAGTGAAGCCACAGATGTAACGATGGTGTAGTCCTCGTTG TGCCTACTGCCTCGGA

shLuc: TGCTGTTGACAGTGAG CGCCCGCCTGAAGTCTCTGATTAATAGTGAAGCCACAGATGTATTAATCAGAGACTTCAGGCGGT TGCCTACTGCCTCGGA

Reações de recombinação LR.

As reações de recombinação de dois plasmídeos foram realizadas usando LR Clonase II em uma reação de 5 µL (10 fmol Entry plasmídeo, 20 fmol Destination plasmídeo, 1 µL LR Clonase II Invitrogen cat # 11791-020). Três e quatro reações de recombinação de plasmídeo usadas LR Clonase II Plus foram realizadas em um total de 5 µL (0,5 µL cada de 10 fmol / µL de Plasmídeo A (attL1 – L2), Plasmídeo B (attR2-L3), Plasmídeo C (attR3-L4) , 0,5 µL de 20 fmol / µL de Plasmídeo de Destino, 0,5 µL de LR Clonase II Plus cat # 12538-120). As reações LR Clonase II foram incubadas por 1 hora e as reações LR Clonase II Plus foram incubadas por 16–24 horas antes do tratamento com proteinase K e transformação em bactérias DH10B quimicamente competentes.

Cultura de células de tecido e transfecções

Cultura de células.

HEK 293T e NIH 3T3 foram cultivados em DMEM (Wisent) contendo + 10% v / v FBS, 1% de penicilina / estreptomicina (Wisent) e 1% v / v 1 M de solução de HEPES a 37 ° C com 5% de CO2. As células foram tripsinizadas e divididas 1/10 em placas frescas em intervalos regulares para evitar que alcancem a confluência. Fibroblastos embrionários de camundongo foram isolados como descrito [29] e foram cultivados em DMEM contendo 10% de FCS, 1% penn / strep. Todos os MEFs foram cultivados por um máximo de 4 passagens.

Transfecções.

Células HEK 293T (5 × 10 6 por placa de 100 mm) foram transfectadas usando uma solução de Polietilenoimina (P.E.I.) a uma razão de 2,65∶1 (massa P.E.I.: massa de DNA) [30]. 42 µL de P.E.I. (1 mg / mL) foi adicionado a 16 µg de DNA de plasmídeo diluído em 600 µL de OMEM e incubado 30 minutos antes da adição às células em DMEM suplementado com FBS a 10%. As células foram incubadas a 37 ° C durante a noite para células 293T ou 6 horas para células NIH 3T3 e, em seguida, o meio foi substituído. Para os ensaios de luciferase, 5 x 10 4 células HEK 293T foram semeadas em cada poço de uma placa de 24 poços antes da transfecção com PEI e 0,74 µg (total) de DNA de plasmídeo por poço.

Produção de vírus e infecções

O lentivírus foi produzido por cotransfecção de pAX2 (5,2 µg), pMDG (2,8 µg) e o plasmídeo viral recombinante (6 µg) (14 µg de DNA total, PEI e razão OMEM conforme descrito anteriormente) em células HEK 293T semeadas a 60% confluência em pratos de 100 mm. Para produzir retrovírus, as linhas produtoras de LNXE foram transfectadas com 16 µg de plasmídeo pREG. Em ambos os casos, o meio foi removido após 48 horas, filtrado através de um filtro de 45 µm e adicionado às células receptoras não diluídas.

Imunoblots

Células NIH 3T3 transduzidas estáveis ​​não foram tratadas ou foram incubadas com 0,2 µg / mL de doxorrubicina durante 6 horas. A proteína total foi extraída de 1 × 10 6 células lisadas a 95 ° C em tampão Laemmli 1X. A proteína foi separada por 10% SDS PAGE e imunotransferida usando métodos padrão com anticorpo anti-p53 primário (diluição 1∶1000, Cell Signaling cat # 2524) ou anticorpo anti-tubulina (1∶8000, Sigma cat # T5168) e um anticorpo HRP- anticorpo secundário conjugado (1∶2500 GE Healthcare Life Sciences cat # NA931VS).

Ensaios de luciferase

As células HEK 293T ou NIH 3T3 foram semeadas (5 × 10 4 células por poço) em um prato de 24 poços e foram incubadas durante a noite. As misturas de DNA continham uma razão molar de 4∶1, 2∶1 ou 1∶1 de plasmídeo lentiviral expressando miRNA para repórter de luciferase (sempre usando 100 ng de plasmídeo repórter) foram feitas até 0,74 µg de DNA de plasmídeo total pela adição de um terceiro recombinante plasmídeo lentiviral sem o cassete de miRNA. As transfecções foram realizadas usando P.E.I. conforme descrito anteriormente. As células foram lavadas com 1X PBS 48 horas após a transfecção e depois lisadas em 100 µL de tampão de lise passivo (Promega cat # E1941) de acordo com as instruções do fabricante. Os conteúdos de luciferase Firefly e Renilla foram quantificados usando uma combinação de leitor / injetor de placas Tecan 200 executando o software i-Control usando 5 µL de HEK 293T e 20 µL de lisados ​​NIH 3T3 para manter a linearidade do sinal. As soluções de ensaio de luciferase foram da Promega (Dual-Luciferase Reporter Assay System cat # E1910) ou feitas conforme descrito [31], [32]. 100 µL de solução de ensaio de luciferase de pirilampo foram injetados por poço, agitados por 2 segundos e a medição de luminescência integrada ao longo de 10 segundos, seguido da mesma maneira pela injeção de 100 µL de solução de ensaio de luciferase de Renilla.

Imagem Celular

A imagem de células de fluorescência foi adquirida usando um microscópio invertido Leica DM IL LED com fonte X-cite série 120 Q UV, acessório de câmera QICAM Fast 1394 (Q IMAGING) e conjuntos de filtros de CHROMA: CFP: ET436 / 20x, ET480 / 40 m, T455lp , GFP: ET470 / 40x, ET525 / 50 m, T495LPXR, dsRed: ET545 / 30x, ET620 / 60 m, T570lp.

Infecção e análise de pulmões de camundongo

Lentivirus feito de plasmídeos recombinantes expressando eGFP, Cre e Luciferase foi produzido e concentrado por centrifugação conforme descrito em [33]. O vírus concentrado foi titulado infectando 1 × 10 5 células HEK 293T por poço de uma placa de 6 poços com diluições lentivirais feitas em 1X PBS em uma diluição de 1∶10 ou 1∶100. A cada poço, foram adicionados 10 µL ou 100 µL na presença de 4 µg / mL de polibreno. A proporção de células positivas para eGFP foi determinada por análise de citometria de fluxo padrão 72 horas após a infecção.

Unidades infecciosas equivalentes de vírus (1–2 × 10 8 IU) foram introduzidas nos pulmões de camundongos Braf CA / + por meio de administração intratraqueal direta (conforme descrito em [33]) após o pré-tratamento com caprato de sódio, que aumenta a eficiência da infecção [ 34]. Os camundongos foram sacrificados 8 e 16 semanas após a infecção e os pulmões foram processados ​​para histologia e Ki67 conforme descrito [35]. As lâminas foram coradas com hematoxilina e eosina (H & ampE) e para Ki67 antes de serem digitalizadas usando um Aperio Scanscope AT. As lâminas individuais foram analisadas por meio do software Aperio ImageScope, em que cada tumor foi circunscrito para obter a área de corte (µm 2) e a porcentagem de células Ki67-positivas foi obtida por meio do Algoritmo Nuclear IHC.


DISCUSSÃO

Os genes que codificam as funções de biossíntese e utilização da anguibactina estão dentro de vários operons que estão localizados em uma região de 25 kb do V. anguillarum plasmídeo de virulência (48). No entanto, para atingir a expressão máxima deste sistema de eliminação de ferro, são necessários produtos de uma região não contígua do plasmídeo. Esta região, designada TAF, codifica trans- fatores atuantes que agem para aumentar a produção do sideróforo anguibactina (48), bem como para aumentar a expressão de um mRNA policistrônico codificado pelo transporte de anguibactina férrica e genes de biossíntese (37).

Neste trabalho, iniciamos a dissecção da região TAF e determinamos que existem pelo menos dois componentes. Um, TAFb, está diretamente associado à biossíntese de anguibactina, enquanto o outro, TAFr, desempenha um papel regulador na expressão do mRNA policistrônico codificado por fatDCBAangRT. O fato de AngR não ser apenas uma proteína reguladora em si, mas também uma enzima biossintética, assim como AngT (52), sugere que TAFr desempenha um papel indireto na biossíntese de anguibactina por meio de seu efeito regulatório sobre os dois genes de biossíntese presentes no mesmo mRNA policistrônico. Nossos resultados apoiam esta hipótese: cepas sem a região TAFr não foram totalmente complementadas por TAFb para a expressão do fatDCBAangRT operon ou para a produção de anguibactina. No entanto, os clones TAFb complementam totalmente ambos para a expressão do fatDCBAangRT operon e para a produção de anguibactina quando a cepa abriga TAFr.

Neste relatório, nos concentramos na análise do componente TAFb. Nossa análise demonstrou que a região TAFb codifica várias ORFs exibindo altos níveis de homologia com proteínas envolvidas na biossíntese e utilização de sideróforos contendo DHBA, como vibriobactina (55) e enterobactina (31, 41). Apenas duas ORFs, B e F, foram encontradas com potencial para codificar proteínas funcionais. No entanto, mostramos pela geração de uma deleção interna que a ORF F não é necessária para a biossíntese da anguibactina. Nossos experimentos de mutagênese e complementação também demonstraram que dois genes dentro da ORF B, agora designados angB e angG, são os únicos genes dentro deste agrupamento que são necessários para a biossíntese da anguibactina. A região TAFb que contém este cluster é flanqueada por elementos de sequência de inserção idênticos e invertidos, formando uma estrutura semelhante a um transposon composto. Sequências de inserção semelhantes flanqueiam o fatDCBAangRT operon (17, 43). Essas observações sugerem que o V. anguillarum O plasmídeo de virulência pode ter adquirido genes de biossíntese e utilização de sideróforos horizontalmente por meio de eventos de transposição. O acaso e a necessidade podem ter levado à aquisição de uma unidade móvel que transportava angB e angG junto com os outros genes, embora angB e angG foram os únicos dois genes neste cluster necessários para a produção de anguibactina. Esses genes não essenciais no agrupamento TAFb podem ter acumulado mutações e se tornar pseudogenes posteriormente na evolução desse sistema. É também de interesse que a organização do gene dos pseudogenes ORF C e ORF E, bem como a angB gene, no agrupamento TAFb é idêntico ao do codificado cromossomicamente vibC, vibe, e vibB genes de V. cholerae (55), e esta organização é distinta daquela dos mesmos genes em E. coli (31, 41). É tentador especular que o cluster TAFb se originou em V. cholerae ou em um organismo ancestral e que foi adquirido pelo V. anguillarum plasmídeo de virulência por meio de eventos de transposição e transferência horizontal.

Membros do laboratório de Earhardt isolaram mutações de transposon na extremidade 3 & # x02032 do entB gene que resultou em proteínas EntB truncadas com o fenótipo EntB & # x0002b Ent & # x02212, sugerindo que uma atividade EntG foi codificada na extremidade 3 & # x02032 do entB gene. A análise imunológica e de transcrição-tradução in vitro identificou apenas uma proteína com massa molecular correspondente à de EntB (41). Portanto, a evidência experimental reunida usando as abordagens descritas acima sugere fortemente que a EntB é uma proteína bifuncional. No entanto, esses pesquisadores apontaram que seus estudos não eliminaram completamente a possibilidade de existir um polipeptídeo EntG separado (41).

Nossa análise genética do componente TAFb angB demonstraram que é uma única ORF que codifica duas funções distintas essenciais para a biossíntese da anguibactina. Qualquer uma dessas duas atividades, B ou G, pode funcionar independentemente da outra: uma mutação de parada no BglSítio II localizado a 194 bp do início da translação de angB, ou uma deleção destes primeiros 194 bp, destrói a atividade B sem afetar a atividade G. Além disso, as deleções de 345 bp da extremidade 3 & # x02032 anulam a atividade G, enquanto a atividade B não é afetada. A atividade B codificada pelo angB gene corresponde a uma proteína de 37 kDa. A versão truncada gerada pela exclusão 3 & # x02032-end, que ainda possui atividade B, também foi identificada em V. anguillarum como uma proteína cuja massa molecular corresponde a 172 aminoácidos. Acreditamos que a atividade B seja uma isocorismato-liase (24, 35) necessária para a conversão do isocorismato em 2,3-di-hidro-2,3-DHBA, não apenas devido ao fato de AngB e EntB apresentarem homologia significativa, mas também porque as mutações de deleção na extremidade 5 & # x02032 do gene que resultam na perda da atividade B são resgatadas pela adição de DHBA. Por outro lado, as cepas carregando apenas a extremidade 5 & # x02032 de angB, possuindo atividade B, mas deficiente em atividade G, secretam DHBA.

Nossa evidência genética atual indica que, pelo menos em angB fundos mutantes, uma entidade independente com atividade G pode existir em V. anguillarum, uma vez que uma cepa com uma mutação apolar na extremidade 5 & # x02032 do angB O gene exibe atividade G mesmo quando esta mutação é introduzida no plasmídeo de virulência por troca alélica. Esta atividade se correlaciona com a presença de três polipeptídeos que são codificados na extremidade 3 & # x02032 do angB gene e são todos traduzidos no mesmo quadro que AngB, conforme demonstrado usando um E. coli sistema de superexpressão e microsequenciamento de proteínas. Embora a evidência genética para a existência de um polipeptídeo AngG separado seja muito forte, não fomos capazes de detectar tal proteína em qualquer V. anguillarum cepa, potencialmente devido aos baixos níveis desta proteína. Por causa disso, não fomos capazes de determinar o significado biológico desta proteína. Nossos esforços atuais são direcionados a elucidar se AngB e / ou um ou todos os polipeptídeos menores codificam a atividade G em células de tipo selvagem, criando mutações silenciosas nos locais de ligação do ribossomo para o angG-polipeptídeos codificados.

Recentemente, Gehring et al.(24) demonstraram que na proteína EntB bifuncional a atividade de montagem de enterobactina reside na porção C-terminal (resíduos 188 a 285) e mostrou que EntB deve ter um domínio de proteína transportadora apo-aril C-terminal que sofre fosfopantetoinilação covalente, muito provavelmente na serina 245, localizada em uma sequência de consenso. A comparação da extremidade carboxi-terminal de AngB com os polipeptídeos AngG e a extremidade carboxi-terminal de EntB identificou um domínio semelhante (FLGLDSI) com um resíduo de serina localizado na posição 248. Em AngB, este domínio se estende dos aminoácidos 243 a 249, e também está presente nas porções correspondentes das proteínas AngG. Nossos resultados demonstraram que uma mutação S248L resulta na perda da atividade G enquanto conserva a atividade B, indicando que este resíduo de serina é essencial para a atividade G. No entanto, não foi possível determinar se a perda de atividade G causada pela mutação em AngB é devido a um efeito nos polipeptídeos AngG apenas ou também na sequência correspondente na extremidade carboxi-terminal de AngB. O que está claro é que a mesma mutação no mutante apolar B & # x02212 G & # x0002b :: K, que deveria apenas sintetizar os polipeptídeos AngG, resulta na perda da atividade G. Uma vez que esta mutação foi uma única alteração de nucleotídeo resultando na mutação S248L, é provável que a alteração esteja ocorrendo apenas no nível da proteína, fornecendo assim mais provas da existência dos polipeptídeos AngG nessas cepas. Os resultados de experimentos de fosforilação in vivo sugerem que a extremidade carboxi-terminal de AngB funciona como uma proteína transportadora de arila envolvida na montagem da molécula de anguibactina. Uma vez que a mutação S248L abole a atividade G em uma cepa que deveria sintetizar apenas os polipeptídeos AngG, é razoável pensar que o local S248 em AngG também é modificado e que AngG é uma proteína transportadora de arila, embora esses polipeptídeos modificados não tenham sido detectados em V. anguillarum.

Nossos esforços atuais são direcionados para elucidar se um ou todos os polipeptídeos menores codificam a atividade G. Também identificamos quadros de leitura abertos dentro da região TAFr que podem codificar as funções responsáveis ​​pela atividade TAFr. As análises destes irão contribuir para a compreensão da natureza molecular da atividade reguladora TAFr codificada pelo V. anguillarum plasmídeo de virulência.