Em formação

Como os ribossomos contribuem para sua própria síntese?

Como os ribossomos contribuem para sua própria síntese?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Em outras palavras, quais produtos sintetizados pelos ribossomos são partes reais dos ribossomos (se houver)? De outra forma, como eles estão envolvidos em sua própria síntese? Qual é o ciclo / cadeia de produtos começando com as proteínas sintetizadas pelos ribossomos e realmente terminando com a síntese de um ribossomo?


As partes mais importantes do ribossomo não são feitas por outros ribossomos - 5 rRNA (RNA ribossômico) do ribossomo na verdade fazem a maior parte do trabalho direto de criação da proteína e são feitas pela RNA polimerase (uma proteína, mas não o ribossomo).

Depois, há 92 proteínas ribossômicas, que via de regra se ligam ao RNA ribossômico para sustentar sua estrutura e manter tudo funcionando. Tudo isso é feito de ribossomos. Acredita-se que eles tenham aparecido mais tarde na evolução do ribossomo, embora eu imagine que não seria possível constituir um ribossomo funcional sem cada um deles.

esses números são para o ribossomo eucariótico, o ribossomo procariótico tem 3 rRNA e 52 componentes de proteína ribossômica.

http://en.wikipedia.org/wiki/Ribosome


Montagem do ribossomo: a etapa final de corte

Os ribossomos sintetizam todas as proteínas nas células. Estudos feitos principalmente em leveduras revelaram muito sobre como os ribossomos são formados, mas uma equipe da Ludwig-Maximilians-Universitaet (LMU) em Munique agora relata que a montagem de ribossomos em células humanas requer fatores que não têm contrapartes em organismos modelo mais simples.

Em cada célula, centenas de milhares de intrincadas máquinas moleculares chamadas ribossomos fabricam novas proteínas, estendendo cada cadeia crescente a uma taxa de alguns aminoácidos por segundo. Não surpreendentemente, portanto, a construção dessas fábricas de proteínas vitais é em si uma operação altamente complexa, na qual mais de 200 fatores de montagem estão temporariamente envolvidos. Os ribossomos maduros são compostos de aproximadamente 80 proteínas e quatro RNAs ribossômicos. Mas como esses constituintes são reunidos na ordem correta para produzir um ribossomo funcional ainda não é totalmente compreendido. Além disso, a maior parte do nosso conhecimento do processo vem de estudos realizados em organismos modelo, como bactérias e leveduras, e pode não ser necessariamente aplicável às células de organismos superiores. Pesquisadores liderados pelo professor Roland Beckmann (Gene Center, LMU Munique) descobriram agora novos detalhes das etapas cruciais na maturação dos ribossomos em células humanas.

Os ribossomos ativos consistem em duas partículas montadas separadamente, que diferem em tamanho e interagem entre si somente após as primeiras etapas na síntese de proteínas terem ocorrido no menor dos dois (nas células humanas, a 'subunidade 40S'). A equipe de Beckmann usou a microscopia crioeletrônica para determinar as estruturas de vários precursores da subunidade 40S isolada de células humanas e acompanhar o curso de sua maturação. "Este estudo é uma continuação de um projeto anterior, no qual obtivemos uma visão inicial do processo", diz Michael Ameismeier. Ele é aluno de doutorado da equipe de Beckmann e principal autor do novo relatório, que trata das etapas finais da montagem da pequena subunidade.

Nesse estágio final do processo, uma extremidade do RNA ribossômico associado à pequena partícula projeta-se do corpo da subunidade imatura. A última etapa da maturação da subunidade 18S consiste na retirada desse segmento agora supérfluo. Para garantir que essa reação não ocorra prematuramente, a enzima responsável - NOB1 - é mantida inativa até que seja necessária. O novo estudo mostra que a ativação de NOB1 é precedida por uma mudança conformacional que resulta no desprendimento de um parceiro de ligação da enzima. Isso, por sua vez, desencadeia um rearranjo estrutural no próprio NOB1, que permite à enzima cortar o segmento de rRNA protuberante. "A ativação de NOB1 é coordenada por outra enzima", explica Ameismeier. Junto com uma proteína que descobrimos - que não é encontrada na levedura - a última enzima se insere como uma cunha na subunidade 40S em maturação, e isso facilita a mudança conformacional decisiva no NOB1. "

Os autores também mostraram que outra proteína não encontrada na levedura desempenha um papel (ainda) enigmático na maturação da subunidade 40S. “Isso demonstra a importância de considerar o sistema humano separadamente de outros modelos experimentais”, diz Beckmann. O uso do sistema de levedura evolutivamente mais simples é suficiente para um entendimento básico do processo. Mas certas síndromes patológicas têm sido associadas a erros na biogênese ribossômica em humanos, o que fornece uma razão óbvia para o estudo da montagem ribossômica em sistemas celulares humanos.


O mecanismo de síntese de proteínas

Tal como acontece com a síntese de mRNA, a síntese de proteínas pode ser dividida em três fases: iniciação, alongamento e término. O processo de tradução é semelhante em procariontes e eucariotos. Aqui, vamos explorar como ocorre a tradução em E. coli, um procariota representativo e especificar quaisquer diferenças entre a tradução procariótica e eucariótica.

Iniciação da Tradução

A síntese de proteínas começa com a formação de um complexo de iniciação. No E. coli, este complexo envolve o pequeno ribossomo 30S, o modelo de mRNA, três fatores de iniciação (IFs IF-1, IF-2 e IF-3) e um tRNA iniciador especial, denominado tRNAMetf. O tRNA iniciador interage com o códon de iniciação AUG (ou raramente, GUG), liga-se a uma metionina formilada chamada fMet e também pode ligar IF-2. A metionina formulada é inserida por fMet-tRNAMetf no início de cada cadeia polipeptídica sintetizada por E. coli, mas geralmente é cortado após a conclusão da tradução. Quando um AUG in-frame é encontrado durante o alongamento da tradução, uma metionina não formilada é inserida por um Met-tRNA Met regular.

No E. coli O mRNA, uma sequência a montante do primeiro códon AUG, chamada de sequência Shine-Dalgarno (AGGAGG), interage com as moléculas de rRNA que compõem o ribossomo. Esta interação ancora a subunidade ribossômica 30S no local correto no modelo de mRNA. Trifosfato de guanosina (GTP), que é um trifosfato de nucleotídeo de purina, atua como uma fonte de energia durante a tradução - tanto no início do alongamento quanto durante a translocação do ribossomo.

Em eucariotos, um complexo de iniciação semelhante se forma, compreendendo mRNA, a pequena subunidade ribossômica 40S, IFs e trifosfatos de nucleosídeo (GTP e ATP). O iniciador tRNA carregado, denominado Met-tRNAeu, não se liga a fMet em eucariotos, mas é diferente de outros Met-tRNAs por poder ligar IFs.

Em vez de se depositar na sequência Shine-Dalgarno, o complexo de iniciação eucariótica reconhece o limite de 7-metilguanosina na extremidade 5 & # 8242 do mRNA. Uma proteína de ligação ao cap (CBP) e vários outros IFs auxiliam no movimento do ribossomo para o cap 5 & # 8242. Uma vez no limite, o complexo de iniciação segue ao longo do mRNA na direção 5 & # 8242 a 3 & # 8242, procurando o códon de início AUG. Muitos mRNAs eucarióticos são traduzidos do primeiro AUG, mas nem sempre é esse o caso. De acordo com as regras de Kozak, os nucleotídeos em torno do AUG indicam se é o códon de início correto. As regras de Kozak afirmam que a seguinte sequência de consenso deve aparecer em torno do AUG dos genes de vertebrados: 5 & # 8242-gccRccAUGG-3 & # 8242. O R (para purina) indica um local que pode ser A ou G, mas não pode ser C ou U. Essencialmente, quanto mais próxima a sequência estiver desse consenso, maior será a eficiência da tradução.

Uma vez que o AUG apropriado é identificado, as outras proteínas e CBP se dissociam, e a subunidade 60S se liga ao complexo de Met-tRNAeu, mRNA e a subunidade 40S. Esta etapa completa o início da tradução em eucariotos.

Tradução, alongamento e rescisão

Em procariotos e eucariotos, os princípios básicos do alongamento são os mesmos, portanto, revisaremos o alongamento da perspectiva de E. coli. A subunidade ribossômica 50S de E. coli consiste em três compartimentos: o sítio A (aminoacil) liga os aminoacil tRNAs carregados de entrada. O sítio P (peptidil) se liga a tRNAs carregados contendo aminoácidos que formaram ligações peptídicas com a cadeia polipeptídica em crescimento, mas ainda não se dissociaram de seu tRNA correspondente. O sítio E (saída) libera tRNAs dissociados para que possam ser recarregados com aminoácidos livres. Há uma exceção a esta linha de montagem de tRNAs: em E. coli, fMet-tRNAMetf é capaz de entrar no site P diretamente, sem primeiro entrar no site A. Da mesma forma, o Met-tRNA eucarióticoeu, com a ajuda de outras proteínas do complexo de iniciação, liga-se diretamente ao sítio P. Em ambos os casos, isso cria um complexo de iniciação com um local A livre pronto para aceitar o tRNA correspondente ao primeiro códon após o AUG.

Durante o alongamento da tradução, o modelo de mRNA fornece especificidade. À medida que o ribossomo se move ao longo do mRNA, cada códon de mRNA entra em registro e a ligação específica com o anticódon de tRNA carregado correspondente é assegurada. Se o mRNA não estivesse presente no complexo de alongamento, o ribossomo se ligaria aos tRNAs de forma não específica.

O alongamento prossegue com tRNAs carregados entrando no local A e, em seguida, mudando para o local P seguido pelo local E com cada "etapa" de códon único do ribossomo. As etapas ribossomais são induzidas por mudanças conformacionais que avançam o ribossomo em três bases na direção 3 & # 8242. A energia para cada etapa do ribossomo é doada por um fator de alongamento que hidrolisa o GTP. As ligações peptídicas se formam entre o grupo amino do aminoácido ligado ao tRNA do local A e o grupo carboxila do aminoácido ligado ao tRNA do local P. A formação de cada ligação peptídica é catalisada pela peptidil transferase, uma enzima baseada em RNA que é integrada na subunidade ribossômica 50S. A energia para cada formação de ligação peptídica é derivada da hidrólise do GTP, que é catalisada por um fator de alongamento separado. O aminoácido ligado ao tRNA do sítio P também está ligado à crescente cadeia polipeptídica. À medida que o ribossomo atravessa o mRNA, o antigo tRNA do local P entra no local E, se desprende do aminoácido e é expelido (Figura 2). Incrivelmente, o E. coli O aparelho de tradução leva apenas 0,05 segundos para adicionar cada aminoácido, o que significa que uma proteína de 200 aminoácidos pode ser traduzida em apenas 10 segundos.

Art Connection

A tradução começa quando um iniciador tRNA anticódon reconhece um códon no mRNA. A subunidade ribossômica grande se junta à subunidade pequena e um segundo tRNA é recrutado. À medida que o mRNA se move em relação ao ribossomo, a cadeia polipeptídica é formada. A entrada de um fator de liberação no site A encerra a tradução e os componentes se dissociam.

Muitos antibióticos inibem a síntese de proteínas bacterianas. Por exemplo, a tetraciclina bloqueia o local A no ribossomo bacteriano e o cloranfenicol bloqueia a transferência de peptidil. Que efeito específico você espera que cada um desses antibióticos tenha na síntese de proteínas?

A tetraciclina afetaria diretamente:

O cloranfenicol afetaria diretamente

O término da tradução ocorre quando um códon sem sentido (UAA, UAG ou UGA) é encontrado. Após o alinhamento com o local A, esses códons sem sentido são reconhecidos por fatores de liberação em procariotos e eucariotos que instruem a peptidil transferase a adicionar uma molécula de água à extremidade carboxila do aminoácido do local P. Essa reação força o aminoácido do sítio P a se desprender de seu tRNA, e a proteína recém-produzida é liberada. As subunidades ribossômicas pequenas e grandes se dissociam do mRNA e umas das outras são recrutadas quase imediatamente para outro complexo de iniciação da tradução. Depois que muitos ribossomos completaram a tradução, o mRNA é degradado para que os nucleotídeos possam ser reutilizados em outra reação de transcrição.


Conteúdo

Os ribossomos são as máquinas macromoleculares responsáveis ​​pela tradução do mRNA em proteínas. O ribossomo eucariótico, também chamado de ribossomo 80S, é composto de duas subunidades - a grande subunidade 60S (que contém o 25S [em plantas] ou 28S [em mamíferos], 5.8S e 5S rRNA e 46 proteínas ribossômicas) e um pequena subunidade 40S (que contém o rRNA 18S e 33 proteínas ribossômicas). [6] As proteínas ribossomais são codificadas por genes ribossômicos.

rRNA encontrado em ribossomos procarióticos e eucarióticos
Modelo Tamanho Subunidade grande (LSU rRNA) Subunidade pequena (SSU rRNA)
procariota 70S 50S (5S: 120 nt, 23S: 2906 nt) 30S (16S: 1542 nt)
eucariótico ANOS 80 60S (5S: 121 nt, [7] 5,8S: 156 nt, [8] 28S: 5070 nt [9]) 40S (18S: 1869 nt [10])

Existem 52 genes que codificam as proteínas ribossomais, e eles podem ser encontrados em 20 operons dentro do DNA procariótico. A regulação da síntese de ribossomos depende da regulação do próprio rRNA.

Primeiro, uma redução no aminoacil-tRNA fará com que a célula procariótica responda diminuindo a transcrição e a tradução. Isso ocorre por meio de uma série de etapas, começando com fatores restritivos que se ligam aos ribossomos e catalisando a reação:
GTP + ATP - & gt pppGpp + AMP

O γ-fosfato é então removido e o ppGpp liga-se e inibe a RNA polimerase. Esta ligação causa uma redução na transcrição do rRNA. Uma quantidade reduzida de rRNA significa que as proteínas ribossomais (r-proteínas) serão traduzidas, mas não terão um rRNA para se ligar. Em vez disso, eles darão feedback negativamente e se vincularão a seus ter mRNA, reprimindo a síntese da proteína r. Observe que as proteínas r ligam-se preferencialmente ao seu rRNA complementar, se estiver presente, ao invés do mRNA.

Os operons do ribossomo também incluem os genes para a RNA polimerase e fatores de alongamento (usados ​​na tradução do RNA). A regulação de todos esses genes de uma vez ilustra o acoplamento entre a transcrição e a tradução em procariotos.

A síntese de proteínas ribossomais em eucariotos é uma importante atividade metabólica. Ocorre, como a maior parte da síntese de proteínas, no citoplasma, logo fora do núcleo. Proteínas ribossômicas individuais são sintetizadas e importadas para o núcleo por meio de poros nucleares. Consulte importação nuclear para obter mais informações sobre o movimento das proteínas ribossômicas para o interior do núcleo.

O DNA é transcrito, em alta velocidade, no nucléolo, que contém todos os genes 45S rRNA. A única exceção é o rRNA 5S que é transcrito fora do nucléolo. Após a transcrição, os rRNAs se associam às proteínas ribossômicas, formando os dois tipos de subunidades ribossômicas (grandes e pequenas). Posteriormente, eles se reunirão no citosol para formar um ribossomo funcional. Consulte exportação nuclear para obter mais informações sobre o movimento das subunidades ribossômicas para fora do núcleo. [11]

Processando Edição

As células eucarióticas co-transcrevem três espécies de rRNA maduras por meio de uma série de etapas. O processo de maturação dos rRNAs e o processo de recrutamento das proteínas r acontecem nas partículas ribossômicas precursoras, às vezes chamadas de pré-ribossomos, e ocorrem no nucléolo, no nucleoplasma e no citoplasma. O fermento, S. cerevisiae é o organismo modelo eucariótico para o estudo da biogênese dos ribossomos. A biogênese do ribossomo começa na nucléolo. Lá, as subunidades 18S, 5.8S e 25S do rRNA são co-transcritas de genes ribossomais como um transcrito policistrônico pela RNA polimerase I, [3] e é chamado de pré-RNA 35S. [1]

A transcrição da polimerase I começa com um complexo de iniciação Pol I que se liga ao promotor do rDNA. A formação deste complexo requer a ajuda de um fator de ativação a montante ou UAF que se associa à proteína de ligação da TATA-box e ao fator central (CF). Juntos, os dois fatores de transcrição permitem que o complexo RNA pol I se ligue ao fator de iniciação da polimerase I, Rrn3. À medida que o transcrito da pol I é produzido, aproximadamente 75 pequenos ribonucleopartículas nucleolares (snoRNPs) facilitam as modificações covalentes co-transcricionais de & gt100 resíduos de rRNA. Esses snoRNPs controlam a metilação de 2'-O-ribose de nucleotídeos e também auxiliam na criação de pseudouridinas. [1] Na extremidade 5 'dos ​​transcritos de rRNA, pequenas subunidades de proteínas ribossômicas (Rps) e fatores não ribossômicos se reúnem com os transcritos pré-RNA para criar botões semelhantes a bolas. Esses botões são as primeiras partículas pré-ribossômicas na via da subunidade ribossômica pequena (40S). [1] O transcrito de rRNA é clivado no sítio A2, e isso separa o pré-ribossomo 40S inicial do pré-rRNA restante que se combinará com proteínas ribossômicas de subunidade grande (Rpl) e outros fatores não ribossômicos para criar o pré- Partículas ribossomais 60S. [1]

Edição de subunidade 40S

A montagem transcricional do precursor da subunidade 40S, às vezes referido como o processome de subunidade pequena (SSU) ou partícula 90S acontece de forma hierárquica - essencialmente uma incorporação gradual dos subcomplexos UTP-A, UTP-B e UTP-C. Esses subcomplexos são compostos por mais de 30 fatores de proteína não ribossomal, a partícula U3 snoRNP, algumas proteínas Rps e o pré-rRNA 35S. Seu papel exato, embora não tenha sido descoberto. [3] A composição da partícula pré-40S muda drasticamente uma vez que a clivagem nos locais dependentes de U3 snoRNPA (locais A0, A1 e A2) é feita. Este evento de clivagem cria o pré-rRNA 20S e faz com que os fatores ribossomais se dissociem da partícula pré-40S. U3 é deslocado do 40S nascente pela helicase Dhr1. [12] Neste ponto no processo de biogênese do ribossomo, o pré-ribossomo 40S já mostra as estruturas de "cabeça" e "corpo" da subunidade 40S madura. O pré-ribossomo 40S é transportado para fora do nucléolo e para o citoplasma. O pré-ribossomo 40S citoplasmático agora contém proteínas ribossômicas, o rRNA 20s e alguns fatores não ribossômicos. A formação final da estrutura de “bico” da subunidade 40S ocorre após um evento de fosforilação e desfosforilação envolvendo o complexo Enp1-Ltv1-Rps3 e a quinase, Hrr25. A clivagem do pré-rRNA 20S no local D cria o rRNA 18s maduro. Este evento de clivagem é dependente de vários fatores não ribossomais, como Nob1, Rio1, Rio2, Tsr1 e Fap7. [1]

Edição de subunidade 60S

A maturação da subunidade pré-60S em uma subunidade 60S madura requer muitos fatores de biogênese que se associam e se desassociam. Além disso, alguns fatores de montagem se associam com a subunidade 60S, enquanto outros interagem com ela apenas temporariamente. Como tendência geral, a maturação da subunidade pré-60S é marcada como uma diminuição gradual da complexidade. A subunidade amadurece à medida que se move do nucléolo para o citoplasma e, gradualmente, o número de fatores de ação trans é reduzido. [3] A maturação da subunidade 60S requer a ajuda de cerca de 80 fatores. Oito desses fatores estão diretamente envolvidos com o processamento do pré-rRNA 27S A3, que na verdade completa a formação da extremidade 5 'madura do rRNA 5.8S.Os fatores A3 ligam-se a locais distantes no pré-RNA, bem como entre si. Posteriormente, eles aproximam áreas de rRNA e promovem o processamento de pré-rRNA e o recrutamento de proteínas ribossomais. Três ATPases do tipo AAA trabalham para retirar os fatores do pré-ribossomo 60S em maturação. Uma das ATPases é uma proteína Rea1 semelhante à dineína composta por 6 domínios ATPase diferentes que formam uma estrutura em anel. A estrutura do anel está ligada a uma cauda flexível que por acaso tem uma ponta MIDAS (local de adesão dependente de íons metálicos). O Rea1 interage com o pré-ribossomo 60S por meio de seu anel, enquanto dois substratos, Ytm1 e Rsa1, interagem com Rea1 por meio de sua ponta MIDAS. O papel desses substratos ainda não foi definido. Porém, ambos, junto com suas interações, são removidos no processo de maturação do pré-ribossomo 60S. As outras duas ATPases, Rix7 e Drg1 também funcionam para remover fatores de montagem da subunidade 60S em maturação. Helicases e GTPases também estão envolvidas na remoção de fatores de montagem e no rearranjo do RNA para formar a subunidade 60S completa. Uma vez no citoplasma (ver exportação nuclear), a subunidade 60S ainda passa por processamento para ser funcional. O resto das partículas ribossômicas de subunidade grande se associam à unidade 60S e os demais fatores de montagem não ribossômica se desassociam. A liberação dos fatores de biogênese é mediada principalmente por GTPases como Lsg1 e ATPases como Drg1. A seqüência precisa desses eventos permanece obscura. A via de maturação citoplasmática 60S permanece incompleta, tanto quanto o conhecimento atual está em causa. [3]

Para que as unidades pré-ribossomais amadureçam completamente, elas devem ser exportadas para o citoplasma. Para mover-se efetivamente do nucléolo para o citoplasma, os pré-ribossomos interagem com os receptores de exportação para se moverem através do canal central hidrofóbico do complexo de poros nucleares. [3] A carioferina Crm1 é o receptor para ambas as subunidades ribossomais e medeia a exportação de um modo dependente de Ran-GTP. Ele reconhece moléculas que possuem sinais de exportação nuclear ricos em leucina. O Crm1 é puxado para a grande subunidade 60S com a ajuda de uma proteína adaptadora chamada Nmd3. A proteína adaptadora para a unidade 40S é desconhecida. Além do Crm1, outros fatores desempenham um papel na exportação nuclear de pré-ribossomos. Um receptor geral de exportação de mRNA, denominado Mex67, bem como uma proteína contendo HEAT, Rrp12, facilitam a exportação de ambas as subunidades. Esses fatores são proteínas não essenciais e ajudam a otimizar a exportação dos pré-ribossomos por serem moléculas grandes. [3]

Como os ribossomos são tão complexos, um certo número de ribossomos são montados incorretamente e podem desperdiçar energia celular e recursos ao sintetizar proteínas não funcionais. Para evitar isso, as células têm um sistema de vigilância ativo para reconhecer ribossomos danificados ou defeituosos e direcioná-los para degradação. O mecanismo de vigilância está em vigor para detectar pré-ribossomos não funcionais, bem como ribossomos maduros não funcionais. Além disso, o sistema de vigilância traz o equipamento de degradação necessário e realmente degrada os ribossomos não funcionais. [1] Os pré-ribossomos que se acumulam no núcleo são destruídos pelo exossomo, que é um complexo de múltiplas subunidades com atividade de exonuclease. Se as subunidades ribossômicas defeituosas saírem do nucléolo e entrarem no citoplasma, existe um segundo sistema de vigilância instalado para direcionar os ribossomos com defeito no citoplasma para degradação. Certas mutações em resíduos da grande subunidade do ribossomo resultarão na decadência do RNA e, portanto, na degradação da unidade. Como a quantidade de defeitos possíveis na montagem do ribossomo é tão extensa, ainda não se sabe como o sistema de vigilância detecta todos os defeitos, mas foi postulado que, em vez de visar defeitos específicos, o sistema de vigilância reconhece as consequências desses defeitos - como atrasos na montagem. Ou seja, se houver uma interrupção na montagem ou maturação de um ribossomo maduro, o sistema de vigilância atuará como se a subunidade estivesse com defeito. [3]

Mutações na biogênese dos ribossomos estão ligadas a várias doenças genéticas da ribossomopatia humana, incluindo síndromes hereditárias de falência da medula óssea, que são caracterizadas por uma predisposição ao câncer e um número reduzido de células sanguíneas. A desregulação ribossomal também pode desempenhar um papel na perda de massa muscular. [13]


Ribossomos e síntese de proteínas

A síntese de proteínas consome mais energia de uma célula do que qualquer outro processo metabólico. Por sua vez, as proteínas são responsáveis ​​por mais massa do que qualquer outro componente dos organismos vivos (com exceção da água), e as proteínas desempenham virtualmente todas as funções de uma célula. O processo de tradução, ou síntese de proteínas, envolve a decodificação de uma mensagem de mRNA em um produto polipeptídico. Os aminoácidos são covalentemente unidos pela interligação de ligações peptídicas em comprimentos que variam de aproximadamente 50 a mais de 1000 resíduos de aminoácidos. Cada aminoácido individual possui um grupo amino (NH2) e um grupo carboxil (COOH). Os polipeptídeos são formados quando o grupo amino de um aminoácido forma uma ligação amida (isto é, peptídeo) com o grupo carboxila de outro aminoácido. Essa reação é catalisada por ribossomos e gera uma molécula de água.

A máquina de síntese de proteínas

Além do modelo de mRNA, muitas moléculas e macromoléculas contribuem para o processo de tradução. A composição de cada componente pode variar entre as espécies, por exemplo, os ribossomos podem consistir em diferentes números de rRNAs e polipeptídeos, dependendo do organismo. No entanto, as estruturas e funções gerais da maquinaria de síntese de proteínas são comparáveis ​​das bactérias às células humanas. A tradução requer a entrada de um modelo de mRNA, ribossomos, tRNAs e vários fatores enzimáticos. (Observação: um ribossomo pode ser considerado uma enzima cujos locais de ligação de aminoácidos são especificados por mRNA.)

Ribossomos

Mesmo antes de um mRNA ser traduzido, uma célula deve investir energia para construir cada um de seus ribossomos. No E. coli, existem entre 10.000 e 70.000 ribossomos presentes em cada célula a qualquer momento. Um ribossomo é uma macromolécula complexa composta de rRNAs estruturais e catalíticos e muitos polipeptídeos distintos. Em eucariotos, o nucléolo é completamente especializado para a síntese e montagem de rRNAs.

Os ribossomos existem no citoplasma dos procariotos e no citoplasma e no retículo endoplasmático rugoso dos eucariotos. As mitocôndrias e os cloroplastos também têm seus próprios ribossomos na matriz e no estroma, que se parecem mais com os ribossomos procarióticos (e têm sensibilidades semelhantes às drogas) do que os ribossomos logo fora de suas membranas externas no citoplasma. Os ribossomos se dissociam em subunidades grandes e pequenas quando não estão sintetizando proteínas e se reassociam durante o início da tradução. Em E. coli, a subunidade pequena é descrita como 30S e a subunidade grande é 50S, para um total de 70S. Os ribossomos de mamíferos têm uma pequena subunidade 40S e uma grande subunidade 60S, para um total de 80S. A subunidade pequena é responsável pela ligação ao molde de mRNA, enquanto a subunidade grande se liga sequencialmente aos tRNAs. Cada molécula de mRNA é traduzida simultaneamente por muitos ribossomos, todos sintetizando proteínas na mesma direção: lendo o mRNA de 5 & # 8242 a 3 & # 8242 e sintetizando o polipeptídeo do terminal N ao terminal C. A estrutura completa do mRNA / poli-ribossomo é chamada de polissoma.

TRNAs

Os tRNAs são moléculas de RNA estruturais que foram transcritas de genes pela RNA polimerase III. Dependendo da espécie, 40 a 60 tipos de tRNAs existem no citoplasma. Os RNAs de transferência atuam como moléculas adaptadoras. Cada tRNA carrega um aminoácido específico e reconhece um ou mais dos códons do mRNA que definem a ordem dos aminoácidos em uma proteína. Os aminoacil-tRNAs se ligam ao ribossomo e adicionam o aminoácido correspondente à cadeia polipeptídica. Portanto, os tRNAs são as moléculas que realmente “traduzem” a linguagem do RNA para a linguagem das proteínas.

Dos 64 códons de mRNA possíveis - ou combinações triplas de A, U, G e C - três especificam a terminação da síntese de proteínas e 61 especificam a adição de aminoácidos à cadeia polipeptídica. Destes 61, um códon (AUG) também codifica o início da tradução. Cada anticódon de tRNA pode emparelhar com um ou mais dos códons de mRNA para seu aminoácido. Por exemplo, se a sequência CUA ocorresse em um molde de mRNA no quadro de leitura apropriado, ela se ligaria a um tRNA de leucina que expressa a sequência complementar, GAU. A capacidade de alguns tRNAs de combinar mais de um códon é o que dá ao código genético sua estrutura em blocos.

Como moléculas adaptadoras de tradução, é surpreendente que os tRNAs possam caber tanta especificidade em um pacote tão pequeno. Considere que os tRNAs precisam interagir com três fatores: 1) eles devem ser reconhecidos pela aminoacil sintetase correta (veja abaixo) 2) eles devem ser reconhecidos pelos ribossomos e 3) eles devem se ligar à sequência correta no mRNA.

Aminoacil ARNt sintetases

O processo de síntese do pré-tRNA pela RNA polimerase III cria apenas a porção de RNA da molécula adaptadora. O aminoácido correspondente deve ser adicionado posteriormente, uma vez que o tRNA é processado e exportado para o citoplasma. Por meio do processo de "carregamento" do tRNA, cada molécula de tRNA é ligada ao seu aminoácido correto por uma de um grupo de enzimas chamadas aminoacil tRNA sintetases. Existe pelo menos um tipo de aminoacil tRNA sintetase para cada um dos 20 aminoácidos. O número exato de aminoacil tRNA sintetases varia por espécie. Essas enzimas primeiro se ligam e hidrolisam ATP para catalisar uma ligação de alta energia entre um aminoácido e monofosfato de adenosina (AMP). Uma molécula de pirofosfato é expelida nesta reação. O aminoácido ativado é então transferido para o tRNA e o AMP é liberado. O termo & # 8220charging & # 8221 é apropriado, uma vez que a ligação de alta energia que anexa um aminoácido ao seu tRNA é posteriormente usada para conduzir a formação da ligação peptídica. Cada tRNA é nomeado de acordo com seu aminoácido.


77 Ribossomos e síntese de proteínas

Ao final desta seção, você será capaz de fazer o seguinte:

  • Descreva as diferentes etapas na síntese de proteínas
  • Discuta o papel dos ribossomos na síntese de proteínas

A síntese de proteínas consome mais energia da célula do que qualquer outro processo metabólico. Por sua vez, as proteínas são responsáveis ​​por mais massa do que qualquer outro componente dos organismos vivos (com exceção da água), e as proteínas desempenham praticamente todas as funções de uma célula. O processo de tradução, ou síntese de proteínas, envolve a decodificação de uma mensagem de mRNA em um produto polipeptídico. Os aminoácidos são covalentemente unidos pela interligação de ligações peptídicas em comprimentos que variam de aproximadamente 50 a mais de 1000 resíduos de aminoácidos. Cada aminoácido individual possui um grupo amino (NH2) e um grupo carboxil (COOH). Os polipeptídeos são formados quando o grupo amino de um aminoácido forma uma ligação amida (isto é, peptídeo) com o grupo carboxila de outro aminoácido ((Figura)). Essa reação é catalisada por ribossomos e gera uma molécula de água.

A máquina de síntese de proteínas

Além do modelo de mRNA, muitas moléculas e macromoléculas contribuem para o processo de tradução. A composição de cada componente pode variar entre as espécies, por exemplo, os ribossomos podem consistir em diferentes números de rRNAs e polipeptídeos, dependendo do organismo. No entanto, as estruturas e funções gerais da maquinaria de síntese de proteínas são comparáveis ​​das bactérias às células humanas. A tradução requer a entrada de um modelo de mRNA, ribossomos, tRNAs e vários fatores enzimáticos. (Observação: um ribossomo pode ser considerado uma enzima cujos locais de ligação de aminoácidos são especificados por mRNA.)

Clique nas etapas deste PBS interativo para ver a síntese de proteínas em ação.

Ribossomos

Mesmo antes de um mRNA ser traduzido, uma célula deve investir energia para construir cada um de seus ribossomos. No E. coli, existem entre 10.000 e 70.000 ribossomos presentes em cada célula em um determinado momento. Um ribossomo é uma macromolécula complexa composta de rRNAs estruturais e catalíticos e muitos polipeptídeos distintos. Em eucariotos, o nucléolo é completamente especializado para a síntese e montagem de rRNAs.

Os ribossomos existem no citoplasma dos procariontes e no citoplasma e no retículo endoplasmático rugoso dos eucariotos. As mitocôndrias e os cloroplastos também têm seus próprios ribossomos na matriz e no estroma, que se parecem mais com os ribossomos procarióticos (e têm sensibilidades semelhantes às drogas) do que os ribossomos logo fora de suas membranas externas no citoplasma. Os ribossomos se dissociam em subunidades grandes e pequenas quando não estão sintetizando proteínas e se reassociam durante o início da tradução. Em E. coli, a subunidade pequena é descrita como 30S, e a subunidade grande é 50S, para um total de 70S (lembre-se de que as unidades de Svedberg não são aditivas). Os ribossomos de mamíferos têm uma pequena subunidade 40S e uma grande subunidade 60S, para um total de 80S. A subunidade pequena é responsável pela ligação ao molde de mRNA, enquanto a subunidade grande se liga sequencialmente aos tRNAs. Cada molécula de mRNA é traduzida simultaneamente por muitos ribossomos, todos sintetizando proteínas na mesma direção: lendo o mRNA de 5 & # 8242 a 3 & # 8242 e sintetizando o polipeptídeo do terminal N ao terminal C. A estrutura completa do mRNA / poli-ribossomo é chamada de polissoma.

TRNAs

Os tRNAs são moléculas de RNA estruturais que foram transcritas de genes pela RNA polimerase III. Dependendo da espécie, 40 a 60 tipos de tRNAs existem no citoplasma. Os RNAs de transferência atuam como moléculas adaptadoras. Cada tRNA carrega um aminoácido específico e reconhece um ou mais dos códons do mRNA que definem a ordem dos aminoácidos em uma proteína. Os aminoacil-tRNAs se ligam ao ribossomo e adicionam o aminoácido correspondente à cadeia polipeptídica. Portanto, os tRNAs são as moléculas que realmente “traduzem” a linguagem do RNA para a linguagem das proteínas.

Dos 64 códons de mRNA possíveis - ou combinações triplas de A, U, G e C - três especificam a terminação da síntese de proteínas e 61 especificam a adição de aminoácidos à cadeia polipeptídica. Destes 61, um códon (AUG) também codifica o início da tradução. Cada anticódon de tRNA pode emparelhar com um ou mais dos códons de mRNA para seu aminoácido. Por exemplo, se a sequência CUA ocorresse em um molde de mRNA no quadro de leitura apropriado, ela se ligaria a um tRNA de leucina que expressa a sequência complementar, GAU. A capacidade de alguns tRNAs de combinar mais de um códon é o que dá ao código genético sua estrutura em blocos.

Como moléculas adaptadoras de tradução, é surpreendente que os tRNAs possam caber tanta especificidade em um pacote tão pequeno. Considere que os tRNAs precisam interagir com três fatores: 1) eles devem ser reconhecidos pela aminoacil sintetase correta (veja abaixo) 2) eles devem ser reconhecidos pelos ribossomos e 3) eles devem se ligar à sequência correta no mRNA.

Aminoacil ARNt sintetases

O processo de síntese do pré-tRNA pela RNA polimerase III cria apenas a porção de RNA da molécula adaptadora. O aminoácido correspondente deve ser adicionado posteriormente, uma vez que o tRNA é processado e exportado para o citoplasma. Por meio do processo de "carregamento" do tRNA, cada molécula de tRNA é ligada ao seu aminoácido correto por uma de um grupo de enzimas chamadas aminoacil tRNA sintetases. Existe pelo menos um tipo de aminoacil tRNA sintetase para cada um dos 20 aminoácidos. O número exato de aminoacil tRNA sintetases varia por espécie. Essas enzimas primeiro se ligam e hidrolisam ATP para catalisar uma ligação de alta energia entre um aminoácido e monofosfato de adenosina (AMP). Uma molécula de pirofosfato é expelida nesta reação. O aminoácido ativado é então transferido para o tRNA e o AMP é liberado. O termo & # 8220charging & # 8221 é apropriado, uma vez que a ligação de alta energia que anexa um aminoácido ao seu tRNA é posteriormente usada para conduzir a formação da ligação peptídica. Cada tRNA é nomeado de acordo com seu aminoácido.

O mecanismo de síntese de proteínas

Tal como acontece com a síntese de mRNA, a síntese de proteínas pode ser dividida em três fases: iniciação, alongamento e término. O processo de tradução é semelhante em procariontes e eucariotos. Aqui, vamos explorar como ocorre a tradução em E. coli, um procariota representativo e especificar quaisquer diferenças entre a tradução procariótica e eucariótica.

Iniciação da Tradução

A síntese de proteínas começa com a formação de um complexo de iniciação. No E. coli, este complexo envolve o pequeno ribossomo 30S, o molde de mRNA, três fatores de iniciação (IFs IF-1, IF-2 e IF-3) e um tRNA iniciador especial, denominado tRNA Metf.

No E. coli O mRNA, uma sequência a montante do primeiro códon AUG, chamada de sequência Shine-Dalgarno (AGGAGG), interage com as moléculas de rRNA que compõem o ribossomo. Esta interação ancora a subunidade ribossômica 30S no local correto no modelo de mRNA. Trifosfato de guanosina (GTP), que é um trifosfato de nucleotídeo de purina, atua como uma fonte de energia durante a tradução - tanto no início do alongamento quanto durante a translocação do ribossomo. A ligação do mRNA ao ribossomo 30S também requer IF-III.

O iniciador tRNA então interage com o códon inicial AUG (ou raramente, GUG). Este tRNA carrega o aminoácido metionina, que é formilado após sua ligação ao tRNA. A formilação cria uma ligação peptídica & # 8220faux & # 8221 entre o grupo formil carboxil e o grupo amino da metionina. A ligação do fMet-tRNA Metf é mediada pelo fator de iniciação IF-2. O fMet começa cada cadeia polipeptídica sintetizada por E. coli, mas geralmente é removido após a conclusão da tradução. Quando um AUG in-frame é encontrado durante o alongamento da tradução, uma metionina não formilada é inserida por um Met-tRNA Met regular. Após a formação do complexo de iniciação, a subunidade ribossomal 30S é unida pela subunidade 50S para formar o complexo de tradução. Em eucariotos, um complexo de iniciação semelhante se forma, compreendendo mRNA, a subunidade ribossômica pequena 40S, IFs eucarióticos e trifosfatos de nucleosídeo (GTP e ATP). A metionina no tRNA iniciador carregado, chamado Met-tRNAeu, não é formilado. No entanto, Met-tRNAeu é distinto de outros Met-tRNAs por poder ligar IFs.

Em vez de se depositar na sequência Shine-Dalgarno, o complexo de iniciação eucariótica reconhece o limite de 7-metilguanosina na extremidade 5 & # 8242 do mRNA. Uma proteína de ligação ao cap (CBP) e vários outros IFs auxiliam no movimento do ribossomo para o cap 5 & # 8242. Uma vez no limite, o complexo de iniciação segue ao longo do mRNA na direção 5 & # 8242 a 3 & # 8242, procurando o códon de início AUG. Muitos mRNAs eucarióticos são traduzidos do primeiro AUG, mas nem sempre é esse o caso.De acordo com as regras de Kozak, os nucleotídeos em torno do AUG indicam se é o códon de início correto. As regras de Kozak afirmam que a seguinte sequência de consenso deve aparecer em torno do AUG dos genes de vertebrados: 5 & # 8242-gccRccAUGG-3 & # 8242. O R (para purina) indica um local que pode ser A ou G, mas não pode ser C ou U. Essencialmente, quanto mais próxima a sequência estiver desse consenso, maior será a eficiência da tradução.

Uma vez que o AUG apropriado é identificado, as outras proteínas e CBP se dissociam, e a subunidade 60S se liga ao complexo de Met-tRNAeu, mRNA e a subunidade 40S. Esta etapa completa o início da tradução em eucariotos.

Tradução, alongamento e rescisão

Em procariotos e eucariotos, os princípios básicos do alongamento são os mesmos, portanto, revisaremos o alongamento da perspectiva de E. coli. Quando o complexo de tradução é formado, a região de ligação do tRNA do ribossomo consiste em três compartimentos. O sítio A (aminoacil) liga-se aos tRNAs de aminoacil carregados de entrada. O sítio P (peptidil) se liga a tRNAs carregados contendo aminoácidos que formaram ligações peptídicas com a cadeia polipeptídica em crescimento, mas ainda não se dissociaram de seu tRNA correspondente. O sítio E (saída) libera tRNAs dissociados para que possam ser recarregados com aminoácidos livres. O metionil-tRNA de iniciação, no entanto, ocupa o local P no início da fase de alongamento da tradução em procariotos e eucariotos.

Durante o alongamento da tradução, o modelo de mRNA fornece especificidade de ligação a tRNA. À medida que o ribossomo se move ao longo do mRNA, cada códon de mRNA entra em registro e a ligação específica com o anticódon de tRNA carregado correspondente é assegurada. Se o mRNA não estivesse presente no complexo de elongação, o ribossomo se ligaria aos tRNAs de maneira não específica e aleatória (?).

O alongamento prossegue com tRNAs carregados entrando e saindo sequencialmente do ribossomo à medida que cada novo aminoácido é adicionado à cadeia polipeptídica. O movimento de um tRNA do sítio A para P para o sítio E é induzido por mudanças conformacionais que avançam o ribossomo por três bases na direção 3 & # 8242. A energia para cada etapa ao longo do ribossomo é doada por fatores de alongamento que hidrolisam o GTP. A energia GTP é necessária tanto para a ligação de um novo aminoacil-tRNA ao local A quanto para sua translocação para o local P após a formação da ligação peptídica. As ligações peptídicas se formam entre o grupo amino do aminoácido ligado ao tRNA do local A e o grupo carboxila do aminoácido ligado ao tRNA do local P. A formação de cada ligação peptídica é catalisada pela peptidil transferase, uma enzima baseada em RNA que é integrada na subunidade ribossômica 50S. A energia para a formação de cada ligação peptídica é derivada da ligação de alta energia que liga cada aminoácido ao seu tRNA. Após a formação da ligação peptídica, o tRNA do local A que agora contém a cadeia de peptídeo em crescimento se move para o local P, e o tRNA do local P que agora está vazio se move para o local E e é expelido do ribossomo ((Figura)). Incrivelmente, o E. coli O aparelho de tradução leva apenas 0,05 segundos para adicionar cada aminoácido, o que significa que uma proteína de 200 aminoácidos pode ser traduzida em apenas 10 segundos.

Muitos antibióticos inibem a síntese de proteínas bacterianas. Por exemplo, a tetraciclina bloqueia o local A no ribossomo bacteriano e o cloranfenicol bloqueia a transferência de peptidil. Que efeito específico você espera que cada um desses antibióticos tenha na síntese de proteínas?

A tetraciclina afetaria diretamente:

O cloranfenicol afetaria diretamente:

O término da tradução ocorre quando um códon sem sentido (UAA, UAG ou UGA) é encontrado. Após o alinhamento com o site A, esses códons sem sentido são reconhecidos por fatores de liberação de proteína que se assemelham a tRNAs. Os fatores de liberação em procariotos e eucariotos instruem a peptidil transferase a adicionar uma molécula de água à extremidade carboxila do aminoácido P-site. Essa reação força o aminoácido do sítio P a se desprender de seu tRNA, e a proteína recém-produzida é liberada. As subunidades ribossômicas pequenas e grandes se dissociam do mRNA e umas das outras são recrutadas quase imediatamente para outro complexo de iniciação da tradução. Depois que muitos ribossomos completaram a tradução, o mRNA é degradado para que os nucleotídeos possam ser reutilizados em outra reação de transcrição.

Dobramento, modificação e direcionamento de proteínas

Durante e após a tradução, os aminoácidos individuais podem ser quimicamente modificados, sequências de sinal anexadas e a nova proteína "dobrada" em uma estrutura tridimensional distinta como resultado de interações intramoleculares. Uma sequência de sinal é uma sequência curta na extremidade amino de uma proteína que a direciona para um compartimento celular específico. Essas sequências podem ser consideradas como a "passagem de trem" da proteína para seu destino final e são reconhecidas por proteínas de reconhecimento de sinal que atuam como condutores. Por exemplo, um terminal de sequência de sinal específico irá direcionar uma proteína para a mitocôndria ou cloroplastos (em plantas). Uma vez que a proteína atinge seu destino celular, a sequência de sinal geralmente é cortada.

Muitas proteínas se dobram espontaneamente, mas algumas proteínas requerem moléculas auxiliares, chamadas acompanhantes, para evitar que eles se agregem durante o complicado processo de dobramento. Mesmo se uma proteína for especificada corretamente por seu mRNA correspondente, ela pode assumir uma forma completamente disfuncional se a temperatura anormal ou condições de pH impedirem que ela se dobre corretamente.

Resumo da Seção

Os atores na tradução incluem o modelo de mRNA, ribossomos, tRNAs e vários fatores enzimáticos. A pequena subunidade ribossômica liga-se ao modelo de mRNA na sequência Shine-Dalgarno (procariotos) ou no cap 5 & # 8242 (eucariotos). A tradução começa no AUG inicial no mRNA, especificando a metionina. A formação de ligações peptídicas ocorre entre aminoácidos sequenciais combinados ao molde de mRNA por seus tRNAs de acordo com o código genético. Os tRNAs carregados entram no sítio ribossômico A e seus aminoácidos se ligam ao aminoácido no sítio P. Todo o mRNA é traduzido em "etapas" de três nucleotídeos do ribossomo. Quando um códon sem sentido é encontrado, um fator de liberação se liga e dissocia os componentes e libera a nova proteína. O dobramento da proteína ocorre durante e após a tradução.

Perguntas de conexão visual

(Figura) Muitos antibióticos inibem a síntese de proteínas bacterianas. Por exemplo, a tetraciclina bloqueia o local A no ribossomo bacteriano e o cloranfenicol bloqueia a transferência de peptidil. Que efeito específico você espera que cada um desses antibióticos tenha na síntese de proteínas?

A tetraciclina afetaria diretamente:

O cloranfenicol afetaria diretamente

(Figura) Tetraciclina: a Cloranfenicol: c.

Perguntas de revisão

Os componentes do RNA dos ribossomos são sintetizados no ________.

Em qualquer espécie, existem pelo menos quantos tipos de aminoacil tRNA sintetases?

Um cientista introduz uma mutação que torna a subunidade ribossômica 60S não funcional em uma linha celular humana. Qual seria o efeito previsto na tradução?

  1. A tradução para após a identificação do códon AUG de iniciação.
  2. O ribossomo não pode catalisar a formação de ligações peptídicas entre os tRNAs nos locais A e P.
  3. O ribossomo não pode interagir com mRNAs.
  4. Os tRNAs não podem sair do sítio E do ribossomo.

Questões de pensamento crítico

Transcreva e traduza a seguinte sequência de DNA (fita não-modelo): 5 & # 8242-ATGGCCGGTTATTAAGCA-3 & # 8242

O mRNA seria: 5 & # 8242-AUGGCCGGUUAUUAAGCA-3 & # 8242. A proteína seria: MAGY. Mesmo que haja seis códons, o quinto códon corresponde a uma parada, então o sexto códon não seria traduzido.

Explique como as alterações de um único nucleotídeo podem ter efeitos muito diferentes na função das proteínas.

Alterações de nucleotídeos na terceira posição dos códons podem não alterar o aminoácido e não teriam efeito sobre a proteína. Outras alterações de nucleotídeos que alteram aminoácidos importantes ou criam ou excluem códons de início ou parada teriam efeitos graves na sequência de aminoácidos da proteína.

Um mRNA normal que lê 5 '- UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3' tem uma mutação de inserção que altera a sequência para 5 '-UGCCAUGGvocêUAAUAACACAUGAGGCCUGAAC– 3 ’. Traduzir o mRNA original e o mRNA mutado e explicar como as mutações de inserção podem ter efeitos dramáticos nas proteínas. (Dica: certifique-se de encontrar o local de iniciação.)

MRNA original: 5 ’–UGCC AUG GUA AUA ACA CAU GAG GCC UGA AC– 3’

Tradução: Met - Val - Ile - Thr - His - Glu - Ala

MRNA mutado: 5 ’–UGCC AUG GvocêU AAU AAC ACA UGA GGCCUGAAC– 3 ’

Tradução: Met - Val - Asn - Asn - Thr

As mutações de inserção podem ter efeitos dramáticos nas proteínas porque mudam o quadro de leitura dos códons. Isso muda os aminoácidos codificados pelo mRNA e pode introduzir locais de início ou parada prematuros.

Glossário


Além do núcleo, as células eucarióticas possuem muitas outras organelas, incluindo ribossomos e mitocôndrias. Os ribossomos estão presentes em todas as células.

Ribossomos

Ribossomos são pequenas organelas e são os locais de síntese (ou montagem) de proteínas. Eles são feitos de proteína ribossômica e RNA ribossômico e são encontrados em células eucarióticas e procarióticas. Ao contrário de outras organelas, os ribossomos não são circundados por uma membrana. Cada ribossomo possui duas partes, uma subunidade grande e uma pequena, conforme mostrado na figura abaixo. As subunidades são anexadas umas às outras. Os ribossomos podem ser encontrados sozinhos ou em grupos dentro do citoplasma. Alguns ribossomos são fixados ao retículo endoplasmático (RE) (como mostrado na figura abaixo), e outros são fixados ao envelope nuclear.

As duas subunidades que constituem um ribossomo, pequenas organelas que são fábricas de proteínas intercelulares.

Ribozimas são moléculas de RNA que catalisam reações químicas, como a tradução. Tradução é o processo de ordenar os aminoácidos na montagem de uma proteína, e a tradução será mais discutida em outro conceito. Resumidamente, os ribossomos interagem com outras moléculas de RNA para formar cadeias de aminoácidos chamadas cadeias polipeptídicas, devido à ligação peptídica que se forma entre os aminoácidos individuais. As cadeias polipeptídicas são construídas a partir das instruções genéticas contidas em uma molécula de RNA mensageiro (mRNA). As cadeias polipeptídicas que são feitas no ER bruto (discutido abaixo) são inseridas diretamente no ER e, em seguida, são transportadas para seus vários destinos celulares. Ribossomos no ER rugoso geralmente produzem proteínas que são destinadas à membrana celular.

Os ribossomos são encontrados em células eucarióticas e procarióticas. Os ribossomos não são envolvidos por uma membrana. As outras organelas encontradas nas células eucarióticas são circundadas por uma membrana.

Mitocôndria

Uma mitocôndria (mitocôndria, plural), é uma organela fechada por membrana que é encontrada na maioria das células eucarióticas. As mitocôndrias são chamadas de & # 8220poderosas & # 8221 da célula porque são os locais da respiração celular, onde usam energia de compostos orgânicos para produzir ATP (trifosfato de adenosina). ATP é a fonte de energia da célula que é usada para coisas como movimento e divisão celular. Parte do ATP é produzida no citosol da célula, mas a maior parte é produzida dentro das mitocôndrias. O número de mitocôndrias em uma célula depende das necessidades de energia da célula. Por exemplo, células musculares humanas ativas podem ter milhares de mitocôndrias, enquanto glóbulos vermelhos menos ativos não têm.

(uma): Micrografia eletrônica de uma única mitocôndria, dentro da qual você pode ver muitas cristas. As mitocôndrias variam de 1 a 10 ¼m de tamanho. (b): Este modelo de mitocôndria mostra o arranjo organizado das membranas interna e externa, a matriz da proteína e as membranas mitocondriais internas dobradas.

Conforme a figura acima (uma) e (b) mostrar, uma mitocôndria tem duas membranas fosfolipídicas. A membrana externa lisa separa a mitocôndria do citosol. A membrana interna tem muitas dobras, chamadas cristas. O interior cheio de fluido da mitocôndria, chamado matriz, é onde a maior parte do ATP da célula é produzida.

Embora a maior parte do DNA de uma célula esteja contida no núcleo da célula, as mitocôndrias têm seu próprio DNA. As mitocôndrias são capazes de se reproduzir assexuadamente, e os cientistas acham que descendem de procariontes. De acordo com a teoria endossimbiótica, as mitocôndrias já foram procariontes de vida livre que infectaram ou foram engolfadas por células eucarióticas antigas. Os procariotos invasores foram protegidos dentro da célula hospedeira eucariótica e, por sua vez, o procarioto forneceu ATP extra para seu hospedeiro.


Mesmo antes de um mRNA ser traduzido, uma célula deve investir energia para construir cada um de seus ribossomos. Ribossomos são a parte da célula que lê as informações na molécula de mRNA e reúne os aminoácidos na ordem correta. Um ribossomo é uma macromolécula muito grande e complexa composta de rRNAs estruturais e catalíticos e muitos polipeptídeos distintos. Em eucariotos, o nucléolo é completamente especializado para a síntese e montagem de rRNAs (o componente de RNA que compõe os ribossomos).

Os ribossomos são compostos de duas subunidades que se juntam para tradução, como um pão de hambúrguer que se junta ao redor da carne (o mRNA). A pequena subunidade é responsável pela ligação do modelo de mRNA, enquanto a grande subunidade se liga sequencialmente tRNAs, um tipo de molécula de RNA que traz aminoácidos para a cadeia crescente do polipeptídeo. Cada molécula de mRNA pode ser traduzida simultaneamente por muitos ribossomos, todos sintetizando proteínas na mesma direção: lendo o mRNA de 5 & # 8242 a 3 & # 8242 e sintetizando o polipeptídeo do terminal N ao terminal C (consulte a Figura 1 e # 8211 o terminal N é o final do aminoácido com o nitrogênio e o terminal C é o final do carbono).

Os ribossomos existem no citoplasma em procariotos e no citoplasma e no retículo endoplasmático rugoso em eucariotos. As mitocôndrias e os cloroplastos também têm seus próprios ribossomos na matriz e no estroma, que se parecem mais com os ribossomos procarióticos (e têm sensibilidades semelhantes às drogas) do que os ribossomos logo fora de suas membranas externas no citoplasma.

Figura 2 A maquinaria de síntese de proteínas inclui as subunidades grandes e pequenas do ribossomo, mRNA e tRNA.

Dependendo da espécie, 40 a 60 tipos de tRNA existem no citoplasma. Servindo como adaptadores, tRNAs específicos se ligam a sequências no molde de mRNA e adicionam o aminoácido correspondente à cadeia polipeptídica. Portanto, os tRNAs são as moléculas que realmente “traduzem” a linguagem do RNA para a linguagem das proteínas.

Cada tRNA é composto de uma molécula de RNA linear que é dobrada em uma forma complexa (Figura 3). Em uma extremidade do tRNA está um anticódon, que reconhece pares de bases com um dos códons do mRNA. Na outra extremidade, um aminoácido específico é anexado. Dos 64 códons de mRNA possíveis - ou combinações triplas de A, U, G e C - três especificam a terminação da síntese de proteínas e 61 especificam a adição de aminoácidos à cadeia polipeptídica. Destes 61, um códon (AUG) também codifica o início da tradução. Cada anticódon de tRNA pode emparelhar com um dos códons de mRNA e adicionar um aminoácido ou terminar a tradução, de acordo com o código genético. Por exemplo, se a sequência CUA ocorresse em um molde de mRNA no quadro de leitura adequado, ela se ligaria a um tRNA que expressa a sequência complementar, GAU, que estaria ligada ao aminoácido leucina.

Figura 3 Figura 3 A molécula de RNA que compõe um tRNA dobras na estrutura 3-D complexa vista aqui. Nesta figura, o anticódon é a seção cinza na parte inferior da estrutura. O aminoácido seria anexado à parte amarela no canto superior direito. Crédito da foto Yikrazuul Wikimedia.

Aminoacil ARNt sintetases

Para que cada tRNA funcione, ele deve ter seu aminoácido específico ligado a ele. No processo de "carregamento" do tRNA, cada molécula de tRNA é ligada ao seu aminoácido correto por um grupo de enzimas chamadas aminoacil tRNA sintetases. Existe pelo menos um tipo de aminoacil tRNA sintetase para cada um dos 20 aminoácidos. O número exato de aminoacil tRNA sintetases varia por espécie. Essas enzimas utilizam a energia do ATP para energizar um aminoácido específico, que é então transferido para o tRNA. Desta forma, as moléculas de tRNA podem ser usadas repetidamente, mas cada tRNA sempre carrega o mesmo aminoácido devido à especificidade das enzimas aminoacil tRNA sintetase.


Ban, N., Nissen, P., Hansen, J., Moore, P. B. & amp Steitz, T. A. A estrutura atômica completa da grande subunidade ribossômica com resolução de 2,4 Å. Ciência 289, 905–920 (2000).Primeira estrutura de uma grande subunidade ribossômica arqueada com resolução atômica.

Schluenzen, F. et al. Estrutura da pequena subunidade ribossômica funcionalmente ativada com resolução de 3,3 angstroms. Célula 102, 615–623 (2000).

Wimberly, B. T. et al. Estrutura da subunidade ribossomal 30S. Natureza 407, 327–339 (2000).Referências 2 e 3 descrever a estrutura de uma pequena subunidade ribossômica bacteriana com resolução atômica.

Yusupov, M. M. et al. Estrutura cristalina do ribossomo com resolução de 5,5 Å. Ciência 292, 883–896 (2001).Um mapa de resolução quase atômica (0,55 nm) de um ribossomo bacteriano inteiro ligado por RNAs mensageiros e RNAs de transferência. Primeira vista detalhada das pontes intersubunidades.

Stark, H. et al. Arranjo de tRNAs em ribossomos pré e pós-translocacionais revelado por criomicroscopia eletrônica. Célula 88, 19–28 (1997).

Stark, H. et al. Visualização do fator de alongamento Tu no Escherichia coli ribossomo. Natureza 389, 403–406 (1997).

Mueller, F. et al. O arranjo 3D do 23S e 5S rRNA no Escherichia coli Subunidade ribossômica 50S com base em uma reconstrução microscópica crioeletrônica com resolução de 7,5 Å. J. Mol. Biol. 298, 35–59 (2000).

Gabashvili, I. S. et al. Estrutura da solução do E. coli Ribossomo 70S com resolução de 11,5 Å. Célula 100, 537–549 (2000).

Agrawal, R. K. et al. Visualização direta de RNAs de transferência de A-, P- e E-site no Escherichia coli ribossomo. Ciência 271, 1000–1002 (1996).

Frank, J. et al. Um modelo de síntese de proteínas baseado em microscopia crioeletrônica do E. coli ribossomo. Natureza 376, 441–444 (1995).

Mueller, F. & amp Brimacombe, R. Um novo modelo para a dobragem tridimensional de Escherichia coli RNA ribossômico 16 S. I. Ajustando o RNA a um mapa microscópico eletrônico 3D a 20 Å. J. Mol. Biol. 271, 524–544 (1997).

Ban, N. et al. Um mapa cristalográfico de raios-X com resolução de 9 Å da grande subunidade ribossômica. Célula 93, 1105–1115 (1998).

Ban, N. et al. Colocação de proteínas e estruturas de RNA em um mapa de resolução de 5 Å da subunidade ribossômica 50S. Natureza 400, 841–847 (1999).

Tocilj, A. et al. A pequena subunidade ribossômica de Thermus thermophilus com resolução de 4,5 Å: ajustes de padrão e a identificação de um local funcional. Proc. Natl Acad. Sci. EUA 96, 14252–14257 (1999).

Cate, J. H., Yusupov, M. M., Yusupova, G. Z., Earnest, T. N. & amp Noller, H. F.Estruturas de cristal de raios-X de complexos funcionais de ribossomo 70S. Ciência 285, 2095–2104 (1999).

Matadeen, R. et al. o Escherichia coli grande subunidade ribossômica com resolução de 7,5 Å. Struct. Fold Des. 7, 1575–1583 (1999).

Ramakrishnan, V. & amp Moore, P. B. Atomic structure at last: the ribosome in 2000. Curr. Opiniões Struct. Biol. 11, 144–154 (2001).A história recente da análise da estrutura ribossômica revisada.

Khaitovich, P., Mankin, A. S., Green, R., Lancaster, L. & amp Noller, H. F. Caracterização de partículas subribossômicas funcionalmente ativas de Thermus aquaticus. Proc. Natl Acad. Sci. EUA 96, 85–90 (1999).

Dahlberg, A. E. O papel funcional do RNA ribossômico na síntese de proteínas. Célula 57, 525–529 (1989).

Nissen, P., Hansen, J., Ban, N., Moore, P. B. & amp Steitz, T. A. A base estrutural da atividade do ribossoma na síntese de ligações peptídicas. Ciência 289, 920–930 (2000).O centro da peptidil-transferase é descrito como uma gaiola de RNA, sem proteínas mais próximas do que 1,8 nm da ligação peptídica a ser sintetizada. A formação da ligação peptídica é proposta para seguir as regras da catálise ácido-básica, conforme descrito nas serina proteases. O ribossomo é descrito como uma ribozima. Veja também as referências 35 e 36.

Agrawal, R. K. et al. Visualização dos movimentos do tRNA no Escherichia coli Ribossomo 70S durante o ciclo de alongamento. J. Cell Biol. 150, 447–460 (2000).Reconstruções de microscopia crioeletrônica tridimensional que oferecem visualizações instantâneas das principais posições ocupadas por RNAs de transferência durante o alongamento.

Frank, J. & amp Agrawal, R. K. A reorganização inter-subunidade tipo catraca do ribossomo durante a translocação. Natureza 406, 318–322 (2000).A análise de microscopia crioeletrônica tridimensional de ribossomos bacterianos em vários estados funcionais revelou uma rotação semelhante a uma catraca da subunidade pequena em relação à subunidade grande após a ligação de EF-G e hidrólise de GTP.

Gabashvili, I. S. et al. Principais rearranjos na estrutura ribossomal 3D 70S causados ​​por uma mudança conformacional no RNA ribossômico 16S. EMBO J. 18, 6501–6507 (1999).

Stark, H., Rodnina, M. V., Wieden, H. J., van Heel, M. & amp Wintermeyer, W. Movimento em grande escala do fator de alongamento G e mudança conformacional extensa do ribossomo durante a translocação. Célula 100, 301–309 (2000).

Agrawal, R. K., Penczek, P., Grassucci, R. A. & amp Frank, J. Visualization of elongation factor G on the Escherichia coli Ribossomo 70S: o mecanismo de translocação. Proc. Natl Acad. Sci. EUA 95, 6134–6138 (1998).

Agrawal, R. K., Heagle, A. B., Penczek, P., Grassucci, R. A. & amp Frank, J. EF-G-dependente GTP hydrolysis induz translocação acompanhada por grandes mudanças conformacionais no ribossomo 70S. Nature Struct. Biol. 6, 643–647 (1999).

Brodersen, D. E. et al. A base estrutural para a ação dos antibióticos tetraciclina, pactamicina e higromicina B na subunidade ribossômica 30S. Célula 103, 1143–1154 (2000).

Carter, A. P. et al. Visão funcional da estrutura da subunidade ribossomal 30S e suas interações com antibióticos. Natureza 407, 340–348 (2000).

Porse, B. T. & amp Garrett, R. A. Ribosomal mechanics, antibiotics, and GTP hydrolysis. Célula 97, 423–426 (1999).

Ogle, J. M. et al. Reconhecimento de RNA de transferência cognato pela subunidade ribossômica 30S. Ciência 292, 897–902 (2001).Insights sobre o processo de decodificação. Demonstração de que a geometria das interações do par de bases Watson-Crick no códon-anticódon é detectada por resíduos de RNA ribossômico 16S específicos após a ligação de um tRNA cognato.

Muth, G. W., Ortoleva-Donnelly, L. & amp Strobel, S. A. Uma única adenosina com um p neutroKa no centro da peptidil transferase ribossomal. Ciência 289, 947–950 (2000).

Zhang, B. & amp Cech, T. R. Formação de ligações peptídicas por em vitro ribozimas selecionadas. Natureza 390, 96–100 (1997).

Zhang, B. & amp Cech, T. R. Peptidyl-transferase ribozymes: trans reações, caracterização estrutural e características semelhantes ao RNA ribossomal. Chem. Biol. 5, 539–553 (1998).

Xiong, L. et al. Mutações de resistência à oxazolidinona em 23S rRNA de Escherichia coli revelar a região central do domínio V como o local primário de ação da droga. J. Bacteriol. 182, 5325–5331 (2000).

Polacek, N., Gaynor, M., Yassin, A. & amp Mankin, A. S. Ribosomal peptidyl transferase pode resistir a mutações do resíduo catalítico putativo. Natureza 411, 498–501 (2001).Mutagênese dirigida ao local em resíduos de RNA ribossômico proposto para estar envolvido na catálise de ligação peptídica. O rRNA é proposto para posicionar os grupos reagentes sem participar diretamente da catálise química.

Barta, A. et al. Mecanismo de formação da ligação peptídica ribossomal. Ciência 291, 203 (2001).Três cartas curtas apresentam uma discussão animada sobre a compreensão atual da reação da peptidil-transferase.

Pugh, G. E., Nicol, S. M. & amp Fuller-Pace, F. V. Interaction of the Escherichia coli DEAD box protein DbpA com 23S ribossomal RNA. J. Mol. Biol. 292, 771–778 (1999).

Dammel, C. S. & amp Noller, H. F. Uma mutação sensível ao frio em 16S rRNA fornece evidências de comutação helicoidal na montagem de ribossomo. Genes Dev. 7, 660–670 (1993).

Colley, A., Beggs, J. D., Tollervey, D. & amp Lafontaine, D. L. Dhr1p, uma suposta DEAH-box RNA helicase, está associada à caixa C + D snoRNP U3. Mol. Célula. Biol. 20, 7238–7246 (2000).

Daugeron, M. C. & amp Linder, P. Caracterização e análise mutacional de levedura Dbp8p, uma suposta RNA helicase envolvida na biogênese do ribossomo. Nucleic Acids Res. 29, 1144–1155 (2001).

de la Cruz, J., Kressler, D. & amp Linder, P. Unwinding RNA in Saccharomyces cerevisiae: Proteínas DEAD-box e famílias relacionadas. Trends Biochem. Sci. 24, 192–198 (1999).

Traub, P. & amp Nomura, M. Estrutura e função de E. coli ribossomos. V. Reconstituição de partículas ribossomais 30S funcionalmente ativas de RNA e proteínas. Proc. Natl Acad. Sci. EUA 59, 777–784 (1968).

Nomura, M. & amp Erdmann, V. A. Reconstitution of 50S ribosomal subunits from dissociated molecular components. Natureza 228, 744–748 (1970).

Culver, G. M. & amp Noller, H. F. Efficient reconstitution of funcional Escherichia coli Subunidades ribossômicas 30S de um conjunto completo de proteínas ribossômicas de subunidades pequenas recombinantes. RNA 5, 832–843 (1999).

Herold, M. & amp Nierhaus, K. H. Incorporação de seis proteínas adicionais para completar o mapa de montagem da subunidade 50S de Escherichia coli ribossomos. J. Biol. Chem. 262, 8826–8833 (1987).

Agalarov, S.C., Sridhar Prasad, G., Funke, P.M., Stout, C.D. & amp Williamson, J.R. Structure of the S15, S6, S18-rRNA complex: assembly of the 30S ribosome central domain. Ciência 288, 107–113 (2000).Insights sobre a montagem da pequena subunidade ribossômica. Verificou-se que a ligação da proteína S15 ao domínio central do RNA ribossômico 16S induz e estabiliza uma reorganização estrutural do rRNA necessária para a ligação das proteínas r subsequentes.

Gomez-Lorenzo, M. G. et al. Localização de EF2 em microscopia crioeletrônica tridimensional no Saccharomyces cerevisiae Ribossomo 80S com resolução de 17,5 Å. EMBO J. 19, 2710–2718 (2000).

Ibba, M. & amp Soll, D. Mecanismos de controle de qualidade durante a tradução. Ciência 286, 1893–1897 (1999).

Nissen, P., Kjeldgaard, M. & amp Nyborg, J. Macromolecular mimicry. EMBO J. 19, 489–495 (2000).

Fourmy, D., Yoshizawa, S. & amp Puglisi, J. D. A ligação de paromomicina induz uma alteração conformacional local no sítio A do rRNA 16S. J. Mol. Biol. 277, 333–345 (1998).

Pioletti, M. et al. Estruturas cristalinas de complexos da pequena subunidade ribossomal com tetraciclina, edeína e IF3. EMBO J. 20, 1829–1839 (2001).

Belova, L., Tenson, T., Xiong, L., McNicholas, P. M. & amp Mankin, A. S. Um novo local de ação antibiótica no ribossomo: interação de evernimicina com a grande subunidade ribossômica. Proc. Natl Acad. Sci. EUA 98, 3726–3731 (2001).

Heffron, S. E. & amp Jurnak, F. Estrutura de um complexo EF-Tu com um antibiótico de peptídeo tiazolil determinado em resolução de 2,35 Å: base atômica para GE2270A inibição de EF-Tu. Bioquímica 39, 37–45 (2000).

Vogeley, L., Palm, G. J., Mesters, J.R. & amp Hilgenfeld, R. Alteração conformacional do fator de alongamento Tu (EF-Tu) induzida por ligação a antibióticos. Estrutura cristalina do complexo entre EF-Tu. PIB e aurodox. J. Biol. Chem. 276, 17149–17155 (2001).

Lafontaine, D. L. & amp Tollervey, D. Nascimento dos snoRNPs: a evolução dos snoRNAs de guia de modificação. Trends Biochem. Sci. 23, 383–388 (1998).

Stage-Zimmermann, T., Schmidt, U. & amp Silver, P. A. Fatores que afetam a exportação nuclear da subunidade ribossômica 60S na Vivo. Mol. Biol. Célula 11, 3777–3789 (2000).

Ho, J. H., Kallstrom, G. & amp Johnson, A. W. Nmd3p é uma proteína adaptadora dependente de Crm1p para exportação nuclear da subunidade ribossômica grande. J. Cell Biol. 151, 1057–1066 (2000).

Gadal, O. et al. A exportação nuclear de subunidades ribossômicas 60S depende de Xpo1p e requer um fator Nmd3p contendo NES que se associa com a proteína de subunidade grande Rpl10p. Mol. Célula. Biol. 21, 3405–3415 (2001).

Moy, T. I. & amp Silver, P. A. A exportação nuclear da pequena subunidade ribossômica requer o ciclo de ran-GTPase e certas nucleoporinas. Genes Dev. 13, 2118–2133 (1999).

Kressler, D., Linder, P. & amp de La Cruz, J. Protein trans- fatores atuantes envolvidos na biogênese do ribossomo em Saccharomyces cerevisiae. Mol. Célula. Biol. 19, 7897–7912 (1999).

Venema, J. & amp Tollervey, D. Ribosome synth in Saccharomyces cerevisiae. Annu. Rev. Genet. 33, 261–311 (1999).

Li, Z., Pandit, S. & amp Deutscher, M.P. RNase G (proteína CafA) e RNase E são ambos necessários para a maturação 5 'do RNA ribossômico 16S. EMBO J. 18, 2878–2885 (1999).

Li, Z., Pandit, S. & amp Deutscher, M.P. A maturação do RNA ribossômico 23S requer a exoribonuclease RNase T. RNA 5, 139–146 (1999).

Deutscher, M. P. & amp Li, Z. Exoribonucleases e seus múltiplos papéis no metabolismo do RNA. Prog. Nucleic Acid Res. Mol. Biol. 66, 67–105 (2000).


Como os ribossomos contribuem para sua própria síntese? - Biologia

Ao final desta seção, você será capaz de fazer o seguinte:

  • Descreva as diferentes etapas na síntese de proteínas
  • Discuta o papel dos ribossomos na síntese de proteínas

A síntese de proteínas consome mais energia da célula do que qualquer outro processo metabólico. Por sua vez, as proteínas são responsáveis ​​por mais massa do que qualquer outro componente dos organismos vivos (com exceção da água), e as proteínas desempenham praticamente todas as funções de uma célula. O processo de tradução, ou síntese de proteínas, envolve a decodificação de uma mensagem de mRNA em um produto polipeptídico. Os aminoácidos são covalentemente unidos pela interligação de ligações peptídicas em comprimentos que variam de aproximadamente 50 a mais de 1000 resíduos de aminoácidos. Cada aminoácido individual possui um grupo amino (NH2) e um grupo carboxil (COOH). Os polipeptídeos são formados quando o grupo amino de um aminoácido forma uma ligação amida (isto é, peptídeo) com o grupo carboxila de outro aminoácido ((Figura)). Essa reação é catalisada por ribossomos e gera uma molécula de água.

Figura 1. Uma ligação peptídica liga a extremidade carboxila de um aminoácido à extremidade amino de outro, produzindo uma molécula de água durante o processo. Para simplificar nesta imagem, apenas os grupos funcionais envolvidos na ligação peptídica são mostrados. As designações R e R & # 8217 referem-se ao resto da estrutura de cada aminoácido.

A máquina de síntese de proteínas

Além do modelo de mRNA, muitas moléculas e macromoléculas contribuem para o processo de tradução. A composição de cada componente pode variar entre as espécies, por exemplo, os ribossomos podem consistir em diferentes números de rRNAs e polipeptídeos, dependendo do organismo. No entanto, as estruturas e funções gerais da maquinaria de síntese de proteínas são comparáveis ​​das bactérias às células humanas. A tradução requer a entrada de um modelo de mRNA, ribossomos, tRNAs e vários fatores enzimáticos. (Observação: um ribossomo pode ser considerado uma enzima cujos locais de ligação de aminoácidos são especificados por mRNA.)

Link para aprendizagem

Clique nas etapas deste PBS interativo para ver a síntese de proteínas em ação.

Ribossomos

Mesmo antes de um mRNA ser traduzido, uma célula deve investir energia para construir cada um de seus ribossomos. No E. coli, existem entre 10.000 e 70.000 ribossomos presentes em cada célula em um determinado momento. Um ribossomo é uma macromolécula complexa composta de rRNAs estruturais e catalíticos e muitos polipeptídeos distintos. Em eucariotos, o nucléolo é completamente especializado para a síntese e montagem de rRNAs.

Os ribossomos existem no citoplasma dos procariontes e no citoplasma e no retículo endoplasmático rugoso dos eucariotos. As mitocôndrias e os cloroplastos também têm seus próprios ribossomos na matriz e no estroma, que se parecem mais com os ribossomos procarióticos (e têm sensibilidades semelhantes às drogas) do que os ribossomos logo fora de suas membranas externas no citoplasma. Os ribossomos se dissociam em subunidades grandes e pequenas quando não estão sintetizando proteínas e se reassociam durante o início da tradução. Em E. coli, a subunidade pequena é descrita como 30S, e a subunidade grande é 50S, para um total de 70S (lembre-se de que as unidades de Svedberg não são aditivas). Os ribossomos de mamíferos têm uma pequena subunidade 40S e uma grande subunidade 60S, para um total de 80S. A subunidade pequena é responsável pela ligação ao molde de mRNA, enquanto a subunidade grande se liga sequencialmente aos tRNAs. Cada molécula de mRNA é traduzida simultaneamente por muitos ribossomos, todos sintetizando proteínas na mesma direção: lendo o mRNA de 5 & # 8242 a 3 & # 8242 e sintetizando o polipeptídeo do terminal N ao terminal C. A estrutura completa do mRNA / poli-ribossomo é chamada de polissoma.

TRNAs

Os tRNAs são moléculas de RNA estruturais que foram transcritas de genes pela RNA polimerase III. Dependendo da espécie, 40 a 60 tipos de tRNAs existem no citoplasma. Os RNAs de transferência atuam como moléculas adaptadoras. Cada tRNA carrega um aminoácido específico e reconhece um ou mais dos códons do mRNA que definem a ordem dos aminoácidos em uma proteína. Os aminoacil-tRNAs se ligam ao ribossomo e adicionam o aminoácido correspondente à cadeia polipeptídica. Portanto, os tRNAs são as moléculas que realmente “traduzem” a linguagem do RNA para a linguagem das proteínas.

Dos 64 códons de mRNA possíveis - ou combinações triplas de A, U, G e C - três especificam a terminação da síntese de proteínas e 61 especificam a adição de aminoácidos à cadeia polipeptídica. Destes 61, um códon (AUG) também codifica o início da tradução. Cada anticódon de tRNA pode emparelhar com um ou mais dos códons de mRNA para seu aminoácido. Por exemplo, se a sequência CUA ocorresse em um molde de mRNA no quadro de leitura apropriado, ela se ligaria a um tRNA de leucina que expressa a sequência complementar, GAU. A capacidade de alguns tRNAs de combinar mais de um códon é o que dá ao código genético sua estrutura em blocos.

Como moléculas adaptadoras de tradução, é surpreendente que os tRNAs possam caber tanta especificidade em um pacote tão pequeno. Considere que os tRNAs precisam interagir com três fatores: 1) eles devem ser reconhecidos pela aminoacil sintetase correta (veja abaixo) 2) eles devem ser reconhecidos pelos ribossomos e 3) eles devem se ligar à sequência correta no mRNA.

Aminoacil ARNt sintetases

O processo de síntese do pré-tRNA pela RNA polimerase III cria apenas a porção de RNA da molécula adaptadora. O aminoácido correspondente deve ser adicionado posteriormente, uma vez que o tRNA é processado e exportado para o citoplasma. Por meio do processo de "carregamento" do tRNA, cada molécula de tRNA é ligada ao seu aminoácido correto por uma de um grupo de enzimas chamadas aminoacil tRNA sintetases. Existe pelo menos um tipo de aminoacil tRNA sintetase para cada um dos 20 aminoácidos. O número exato de aminoacil tRNA sintetases varia por espécie. Essas enzimas primeiro se ligam e hidrolisam ATP para catalisar uma ligação de alta energia entre um aminoácido e monofosfato de adenosina (AMP). Uma molécula de pirofosfato é expelida nesta reação. O aminoácido ativado é então transferido para o tRNA e o AMP é liberado. O termo & # 8220charging & # 8221 é apropriado, uma vez que a ligação de alta energia que anexa um aminoácido ao seu tRNA é posteriormente usada para conduzir a formação da ligação peptídica. Cada tRNA é nomeado de acordo com seu aminoácido.

O mecanismo de síntese de proteínas

Tal como acontece com a síntese de mRNA, a síntese de proteínas pode ser dividida em três fases: iniciação, alongamento e término. O processo de tradução é semelhante em procariontes e eucariotos. Aqui, vamos explorar como ocorre a tradução em E. coli, um procariota representativo e especificar quaisquer diferenças entre a tradução procariótica e eucariótica.

Iniciação da Tradução

A síntese de proteínas começa com a formação de um complexo de iniciação. No E. coli, este complexo envolve o pequeno ribossomo 30S, o molde de mRNA, três fatores de iniciação (IFs IF-1, IF-2 e IF-3) e um tRNA iniciador especial, denominado tRNA Metf.

No E. coli O mRNA, uma sequência a montante do primeiro códon AUG, chamada de sequência Shine-Dalgarno (AGGAGG), interage com as moléculas de rRNA que compõem o ribossomo. Esta interação ancora a subunidade ribossômica 30S no local correto no modelo de mRNA. Trifosfato de guanosina (GTP), que é um trifosfato de nucleotídeo de purina, atua como uma fonte de energia durante a tradução - tanto no início do alongamento quanto durante a translocação do ribossomo. A ligação do mRNA ao ribossomo 30S também requer IF-III.

O iniciador tRNA então interage com o códon inicial AUG (ou raramente, GUG). Este tRNA carrega o aminoácido metionina, que é formilado após sua ligação ao tRNA. A formilação cria uma ligação peptídica & # 8220faux & # 8221 entre o grupo formil carboxil e o grupo amino da metionina. A ligação do fMet-tRNA Metf é mediada pelo fator de iniciação IF-2. O fMet começa cada cadeia polipeptídica sintetizada por E. coli, mas geralmente é removido após a conclusão da tradução. Quando um AUG in-frame é encontrado durante o alongamento da tradução, uma metionina não formilada é inserida por um Met-tRNA Met regular. Após a formação do complexo de iniciação, a subunidade ribossomal 30S é unida pela subunidade 50S para formar o complexo de tradução. Em eucariotos, um complexo de iniciação semelhante se forma, compreendendo mRNA, a subunidade ribossômica pequena 40S, IFs eucarióticos e trifosfatos de nucleosídeo (GTP e ATP). A metionina no tRNA iniciador carregado, chamado Met-tRNAeu, não é formilado. No entanto, Met-tRNAeu é distinto de outros Met-tRNAs por poder ligar IFs.

Em vez de se depositar na sequência Shine-Dalgarno, o complexo de iniciação eucariótica reconhece o limite de 7-metilguanosina na extremidade 5 & # 8242 do mRNA. Uma proteína de ligação ao cap (CBP) e vários outros IFs auxiliam no movimento do ribossomo para o cap 5 & # 8242. Uma vez no limite, o complexo de iniciação segue ao longo do mRNA na direção 5 & # 8242 a 3 & # 8242, procurando o códon de início AUG. Muitos mRNAs eucarióticos são traduzidos do primeiro AUG, mas nem sempre é esse o caso. De acordo com as regras de Kozak, os nucleotídeos em torno do AUG indicam se é o códon de início correto. As regras de Kozak afirmam que a seguinte sequência de consenso deve aparecer em torno do AUG dos genes de vertebrados: 5 & # 8242-gccRccAUGG-3 & # 8242. O R (para purina) indica um local que pode ser A ou G, mas não pode ser C ou U. Essencialmente, quanto mais próxima a sequência estiver desse consenso, maior será a eficiência da tradução.

Uma vez que o AUG apropriado é identificado, as outras proteínas e CBP se dissociam, e a subunidade 60S se liga ao complexo de Met-tRNAeu, mRNA e a subunidade 40S.Esta etapa completa o início da tradução em eucariotos.

Tradução, alongamento e rescisão

Em procariotos e eucariotos, os princípios básicos do alongamento são os mesmos, portanto, revisaremos o alongamento da perspectiva de E. coli. Quando o complexo de tradução é formado, a região de ligação do tRNA do ribossomo consiste em três compartimentos. O sítio A (aminoacil) liga-se aos tRNAs de aminoacil carregados de entrada. O sítio P (peptidil) se liga a tRNAs carregados contendo aminoácidos que formaram ligações peptídicas com a cadeia polipeptídica em crescimento, mas ainda não se dissociaram de seu tRNA correspondente. O sítio E (saída) libera tRNAs dissociados para que possam ser recarregados com aminoácidos livres. O metionil-tRNA de iniciação, no entanto, ocupa o local P no início da fase de alongamento da tradução em procariotos e eucariotos.

Durante o alongamento da tradução, o modelo de mRNA fornece especificidade de ligação a tRNA. À medida que o ribossomo se move ao longo do mRNA, cada códon de mRNA entra em registro e a ligação específica com o anticódon de tRNA carregado correspondente é assegurada. Se o mRNA não estivesse presente no complexo de elongação, o ribossomo se ligaria aos tRNAs de maneira não específica e aleatória (?).

O alongamento prossegue com tRNAs carregados entrando e saindo sequencialmente do ribossomo à medida que cada novo aminoácido é adicionado à cadeia polipeptídica. O movimento de um tRNA do sítio A para P para o sítio E é induzido por mudanças conformacionais que avançam o ribossomo por três bases na direção 3 & # 8242. A energia para cada etapa ao longo do ribossomo é doada por fatores de alongamento que hidrolisam o GTP. A energia GTP é necessária tanto para a ligação de um novo aminoacil-tRNA ao local A quanto para sua translocação para o local P após a formação da ligação peptídica. As ligações peptídicas se formam entre o grupo amino do aminoácido ligado ao tRNA do local A e o grupo carboxila do aminoácido ligado ao tRNA do local P. A formação de cada ligação peptídica é catalisada pela peptidil transferase, uma enzima baseada em RNA que é integrada na subunidade ribossômica 50S. A energia para a formação de cada ligação peptídica é derivada da ligação de alta energia que liga cada aminoácido ao seu tRNA. Após a formação da ligação peptídica, o tRNA do local A que agora contém a cadeia de peptídeo em crescimento se move para o local P, e o tRNA do local P que agora está vazio se move para o local E e é expelido do ribossomo ((Figura)). Incrivelmente, o E. coli O aparelho de tradução leva apenas 0,05 segundos para adicionar cada aminoácido, o que significa que uma proteína de 200 aminoácidos pode ser traduzida em apenas 10 segundos.

Art Connection

Figura 2. A tradução começa quando um anticódon iniciador tRNA reconhece um códon inicial no mRNA ligado a uma pequena subunidade ribossômica. A subunidade ribossômica grande se junta à subunidade pequena e um segundo tRNA é recrutado. Conforme o mRNA se move em relação ao ribossomo, sucessivos tRNAs se movem através do ribossomo e a cadeia polipeptídica é formada. A entrada de um fator de liberação no site A encerra a tradução e os componentes se dissociam.

Muitos antibióticos inibem a síntese de proteínas bacterianas. Por exemplo, a tetraciclina bloqueia o local A no ribossomo bacteriano e o cloranfenicol bloqueia a transferência de peptidil. Que efeito específico você espera que cada um desses antibióticos tenha na síntese de proteínas?

A tetraciclina afetaria diretamente:

O cloranfenicol afetaria diretamente:

Tetraciclina: a Cloranfenicol: c.

O término da tradução ocorre quando um códon sem sentido (UAA, UAG ou UGA) é encontrado. Após o alinhamento com o site A, esses códons sem sentido são reconhecidos por fatores de liberação de proteína que se assemelham a tRNAs. Os fatores de liberação em procariotos e eucariotos instruem a peptidil transferase a adicionar uma molécula de água à extremidade carboxila do aminoácido P-site. Essa reação força o aminoácido do sítio P a se desprender de seu tRNA, e a proteína recém-produzida é liberada. As subunidades ribossômicas pequenas e grandes se dissociam do mRNA e umas das outras são recrutadas quase imediatamente para outro complexo de iniciação da tradução. Depois que muitos ribossomos completaram a tradução, o mRNA é degradado para que os nucleotídeos possam ser reutilizados em outra reação de transcrição.

Dobramento, modificação e direcionamento de proteínas

Durante e após a tradução, os aminoácidos individuais podem ser quimicamente modificados, sequências de sinal anexadas e a nova proteína "dobrada" em uma estrutura tridimensional distinta como resultado de interações intramoleculares. Uma sequência de sinal é uma sequência curta na extremidade amino de uma proteína que a direciona para um compartimento celular específico. Essas sequências podem ser consideradas como a "passagem de trem" da proteína para seu destino final e são reconhecidas por proteínas de reconhecimento de sinal que atuam como condutores. Por exemplo, um terminal de sequência de sinal específico irá direcionar uma proteína para a mitocôndria ou cloroplastos (em plantas). Uma vez que a proteína atinge seu destino celular, a sequência de sinal geralmente é cortada.

Muitas proteínas se dobram espontaneamente, mas algumas proteínas requerem moléculas auxiliares, chamadas acompanhantes, para evitar que eles se agregem durante o complicado processo de dobramento. Mesmo se uma proteína for especificada corretamente por seu mRNA correspondente, ela pode assumir uma forma completamente disfuncional se a temperatura anormal ou condições de pH impedirem que ela se dobre corretamente.

Resumo da Seção

Os atores na tradução incluem o modelo de mRNA, ribossomos, tRNAs e vários fatores enzimáticos. A pequena subunidade ribossômica liga-se ao modelo de mRNA na sequência Shine-Dalgarno (procariotos) ou no cap 5 & # 8242 (eucariotos). A tradução começa no AUG inicial no mRNA, especificando a metionina. A formação de ligações peptídicas ocorre entre aminoácidos sequenciais combinados ao molde de mRNA por seus tRNAs de acordo com o código genético. Os tRNAs carregados entram no sítio ribossômico A e seus aminoácidos se ligam ao aminoácido no sítio P. Todo o mRNA é traduzido em "etapas" de três nucleotídeos do ribossomo. Quando um códon sem sentido é encontrado, um fator de liberação se liga e dissocia os componentes e libera a nova proteína. O dobramento da proteína ocorre durante e após a tradução.

Art Connections

(Figura) Muitos antibióticos inibem a síntese de proteínas bacterianas. Por exemplo, a tetraciclina bloqueia o local A no ribossomo bacteriano e o cloranfenicol bloqueia a transferência de peptidil. Que efeito específico você espera que cada um desses antibióticos tenha na síntese de proteínas?


Ribossomos e conjunto de proteínas

A síntese de proteínas ocorre pelos processos de transcrição e tradução. Na transcrição, o código genético contido no DNA é transcrito em uma versão de RNA do código conhecido como RNA mensageiro (mRNA). O mRNA transcrito é transportado do núcleo para o citoplasma, onde é submetido à tradução. Na tradução, uma cadeia crescente de aminoácidos, também chamada de cadeia polipeptídica, é produzida. Os ribossomos ajudam a traduzir o mRNA ligando-se à molécula e ligando os aminoácidos para produzir uma cadeia polipeptídica. A cadeia polipeptídica eventualmente se torna uma proteína totalmente funcional. As proteínas são polímeros biológicos muito importantes em nossas células, pois estão envolvidas em praticamente todas as funções celulares.

Existem algumas diferenças entre a síntese de proteínas em eucariotos e procariontes. Como os ribossomos eucarióticos são maiores do que os procariotos, eles requerem mais componentes proteicos. Outras diferenças incluem diferentes sequências de aminoácidos iniciadores para iniciar a síntese de proteínas, bem como diferentes fatores de alongamento e terminação.


Assista o vídeo: Jak POPRAWIĆ PAMIĘĆ- genialne sposoby (Agosto 2022).