Em formação

Qual é a aparência do núcleo na fase S da meiose?

Qual é a aparência do núcleo na fase S da meiose?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estava assistindo a um vídeo de animação sobre Meiose e é isso que o vídeo mostra (fotos em anexo) Mostra que antes da síntese, cada cromossomo existe como uma única cromátide e, depois da replicação, tem uma cromátide irmã. Estou confuso porque as células germinativas são diplóides, então a fase S não deveria ter esta aparência? Ele deve começar com 23 cromossomos (46 DNAs diferentes) e então replicar para 46 cromossomos (92 DNAs diferentes), que então são classificados em 4 células diferentes?


Em termos de número de cromossomos

Durante a meiose, o meiócito é uma célula diplóide (46 cromossomos para humanos). Portanto, durante a fase S, o meiócito conteria 46 cromossomos.

No final da meiose I, o meiócito dividido contém 23 cromossomos, por isso é chamado de divisão redutora

No final da meiose II, cada célula contém 23 cromossomos.

Em termos de número de cromátides e número de moléculas de DNA

Meiócito na fase S contém 2 cromátides em cada cromossomo, então o número de moléculas de DNA é dobrado (se você considerar que cada cromátide é composta por um par de fitas de DNA como no modelo de Watson Crick, então cada cromossomo da fase S contém 4 fios… Então 46 × 4 fitas de DNA estão presentes. Freqüentemente cada hélice / duplex é considerado uma molécula de DNA , então, nesse caso, você tem 46 × 2 moléculas. Portanto, você deve ter cuidado com a terminologia mencionada.

Após a meiose I, existem 23 cromossomos em cada célula dividida com 2 cromátides em cada cromossomo ... Portanto, existem 23 × 2 moléculas de DNA.

Após a meiose II, existem 23 cromossomos com 1 cromátide… Portanto, eles contêm apenas 23 moléculas de DNA.


Afirma mitose aqui, mas é o mesmo para meiose neste estágio. O que você desenhou para o interior da primeira célula já são 44 cromossomos.

Espero que isto ajude


No início, as células germinativas são diplóides e, tanto quanto sei, são as células que dão origem aos gametas que são haplóides.

Aqui está como vai, a célula germinativa contém 46 cromossomos e na fase S, esses cromossomos se replicam de forma que cada cromossomo será feito de 2 cromátides, resultando em 92 cromátides.

Na meiose I, a célula germinativa se divide e os 46 cromossomos também se dividem, dando origem a duas células, cada uma contendo 23 cromossomos e 46 cromátides.

A meiose ainda não terminou. Na meiose II, cada célula filha contendo 23 cromossomos se dividirá em duas células filhas. Nessa divisão, as cromátides em cada cromossomo se separarão. Em outras palavras, as 46 cromátides em cada célula se dividirão e cada célula das novas células-filhas conterá 23 cromátides. Portanto, agora temos 4 células haplóides, cada uma contendo 23 CROMATIDS (um gameta), todos vindos de uma célula germinativa diplóide original.

Essas cromátides serão então chamadas de cromossomos.


Qual é a aparência do núcleo na fase S da meiose? - Biologia

O núcleo é uma organela altamente especializada que serve como centro de informação e administração da célula. Esta organela tem duas funções principais. Ele armazena o material hereditário da célula, ou DNA, e coordena as atividades da célula, que incluem metabolismo intermediário, crescimento, síntese de proteínas e reprodução (divisão celular).

Apenas as células de organismos avançados, conhecidos como eucariotos, têm um núcleo. Geralmente, há apenas um núcleo por célula, mas há exceções, como fungos viscosos e o grupo de algas Siphonales. Organismos unicelulares mais simples (procariontes), como as bactérias e as cianobactérias, não têm núcleo. Nesses organismos, todas as informações e funções administrativas da célula estão dispersas por todo o citoplasma.

O núcleo esférico ocupa cerca de 10 por cento do volume de uma célula, tornando-se a característica mais proeminente da célula. A maior parte do material nuclear consiste em cromatina, a forma não estruturada do DNA da célula que se organizará para formar cromossomos durante a mitose ou divisão celular. Também dentro do núcleo está o nucléolo, uma organela que sintetiza conjuntos macromoleculares produtores de proteínas chamados ribossomos.

Uma membrana de dupla camada, o envelope nuclear, separa o conteúdo do núcleo do citoplasma celular. O envelope é crivado de buracos chamados de poros nucleares que permitem que tipos e tamanhos específicos de moléculas passem para frente e para trás entre o núcleo e o citoplasma. Também está ligado a uma rede de túbulos, chamada retículo endoplasmático, onde ocorre a síntese de proteínas. Esses túbulos se estendem por toda a célula e fabricam os produtos bioquímicos que um determinado tipo de célula é geneticamente codificado para produzir.

Cromatina / Cromossomos - Empacotados dentro do núcleo de cada célula humana estão quase 2 metros de DNA, que são divididos em 46 moléculas individuais, uma para cada cromossomo e cada uma com cerca de 1,5 polegadas de comprimento. Empacotar todo esse material em um núcleo de célula microscópica é uma façanha extraordinária de empacotamento. Para que o DNA funcione, ele não pode ser enfiado no núcleo como uma bola de barbante. Em vez disso, ele é combinado com proteínas e organizado em uma estrutura compacta e precisa, uma fibra densa semelhante a um fio chamada cromatina.

Cada fita de DNA envolve grupos de pequenas moléculas de proteína chamadas histonas, formando uma série de estruturas semelhantes a contas, chamadas de nucleossomos, conectadas pela fita de DNA. Ao microscópio, a cromatina não condensada tem a aparência de "contas em um cordão".

A cadeia de nucleossomos, já compactada por um fator de seis, é então enrolada em uma estrutura ainda mais densa, compactando o DNA por um fator de 40. Essa compressão e estruturação do DNA tem várias funções. A carga negativa geral do DNA é neutralizada pela carga positiva das moléculas de histonas, o DNA ocupa muito menos espaço e o DNA inativo pode ser dobrado em locais inacessíveis até que seja necessário.

Existem dois tipos de cromatina. A eucromatina é a porção geneticamente ativa e está envolvida na transcrição do RNA para a produção de proteínas utilizadas na função e no crescimento celular. A heterocromatina contém DNA inativo e é a porção da cromatina que mais se condensa, por não estar em uso.

Ao longo da vida de uma célula, as fibras da cromatina assumem diferentes formas dentro do núcleo. Durante a interfase, quando a célula está realizando suas funções normais, a cromatina é dispersa por todo o núcleo no que parece ser um emaranhado de fibras. Isso expõe a eucromatina e a torna disponível para o processo de transcrição.

Quando a célula entra em metáfase e se prepara para se dividir, a cromatina muda drasticamente. Primeiro, todas as fitas de cromatina fazem cópias de si mesmas por meio do processo de replicação do DNA. Em seguida, eles são compactados em um grau ainda maior do que na interfase, uma compactação de 10.000 vezes, em estruturas especializadas para reprodução, chamadas de cromossomos. À medida que a célula se divide para se tornar duas células, os cromossomos se separam, dando a cada célula uma cópia completa da informação genética contida na cromatina.

Nucléolo - o nucléolo é uma organela sem membrana dentro do núcleo que fabrica ribossomos, as estruturas produtoras de proteínas da célula. Através do microscópio, o nucléolo parece uma grande mancha escura dentro do núcleo. Um núcleo pode conter até quatro nucléolos, mas dentro de cada espécie o número de nucléolos é fixo. Depois que uma célula se divide, um nucléolo é formado quando os cromossomos são reunidos em regiões organizadoras de nucléolos. Durante a divisão celular, o nucléolo desaparece. Alguns estudos sugerem que o nucléolo pode estar envolvido com o envelhecimento celular e, portanto, pode afetar o envelhecimento de um organismo.

Envelope nuclear - o envelope nuclear é uma membrana de dupla camada que envolve o conteúdo do núcleo durante a maior parte do ciclo de vida da célula. O espaço entre as camadas é chamado de espaço perinuclear e parece se conectar com o retículo endoplasmático rugoso. O envelope é perfurado com pequenos orifícios chamados de poros nucleares. Esses poros regulam a passagem de moléculas entre o núcleo e o citoplasma, permitindo que algumas passem pela membrana, mas não outras. A superfície interna possui um revestimento protéico denominado lâmina nuclear, que se liga à cromatina e a outros componentes nucleares. Durante a mitose, ou divisão celular, o envelope nuclear se desintegra, mas se reforma conforme as duas células completam sua formação e a cromatina começa a se desfazer e se dispersar.

Poros nucleares - o envelope nuclear é perfurado por orifícios chamados de poros nucleares. Esses poros regulam a passagem de moléculas entre o núcleo e o citoplasma, permitindo que algumas passem pela membrana, mas não outras. Os blocos de construção para a construção de DNA e RNA são permitidos no núcleo, bem como moléculas que fornecem a energia para a construção de material genético.

Os poros são totalmente permeáveis ​​a pequenas moléculas até o tamanho das menores proteínas, mas formam uma barreira que mantém a maioria das moléculas grandes fora do núcleo. Algumas proteínas maiores, como as histonas, são admitidas no núcleo. Cada poro é cercado por uma elaborada estrutura de proteína chamada complexo de poro nuclear, que provavelmente seleciona grandes moléculas para entrar no núcleo.


Representação Esquemática de um Núcleo

Como organela que contém o material genético de uma célula, o núcleo pode ser descrito como o centro de comando. Como tal, o núcleo é constituído por uma série de elementos estruturados que lhe permitem desempenhar as suas funções. Esta seção enfoca a estrutura da célula.

Em geral, o núcleo tem uma forma esférica, como mostrado na maioria dos livros. No entanto, pode parecer achatado, elipsoidal ou irregular, dependendo do tipo de célula. Por exemplo, o núcleo das células do epitélio colunar parece mais alongado em comparação com os de outras células. A forma de um núcleo, no entanto, também pode mudar à medida que a célula amadurece.


Dissolução do Envelope Nuclear

Na maioria das células, a desmontagem do envelope nuclear marca o fim da prófase da mitose (Figura 8.29). No entanto, essa desmontagem do núcleo não é uma característica universal da mitose e não ocorre em todas as células. Alguns eucariotos unicelulares (por exemplo, leveduras) sofrem a chamada mitose fechada, na qual o envelope nuclear permanece intacto (Figura 8.30). Na mitose fechada, os cromossomos filhos migram para pólos opostos do núcleo, que então se divide em dois. As células de eucariotos superiores, entretanto, geralmente sofrem mitose aberta, que é caracterizada pela quebra do envelope nuclear. Os cromossomos filhos então migram para pólos opostos do fuso mitótico, e novos núcleos se reúnem ao redor deles.

Figura 8.29

O núcleo durante a mitose. Micrografias que ilustram os estágios progressivos da mitose em uma célula vegetal. Durante a prófase, os cromossomos se condensam, o nucléolo desaparece e o envelope nuclear se quebra. Na metáfase, os cromossomos condensados ​​(mais.)

Figura 8.30

Mitose aberta e fechada. Na mitose fechada, o envelope nuclear permanece intacto e os cromossomos migram para pólos opostos de um fuso dentro do núcleo. Na mitose aberta, o envelope nuclear se quebra e, em seguida, se forma novamente em torno dos dois conjuntos separados (mais).

A desmontagem do envelope nuclear, que se assemelha a uma quebra semelhante do retículo endoplasmático, envolve mudanças em todos os três de seus componentes: as membranas nucleares são fragmentadas em vesículas, os complexos de poros nucleares se dissociam e a lâmina nuclear se despolimeriza. O mais bem compreendido desses eventos é a despolimerização da lâmina nuclear & # x02014 a malha de filamentos subjacente à membrana nuclear. A lâmina nuclear é composta de proteínas fibrosas, lâminas, que se associam para formar filamentos. A desmontagem da lâmina nuclear resulta da fosforilação das lâminas, que faz com que os filamentos se quebrem em dímeros de lâmina individuais (Figura 8.31). A fosforilação das laminas é catalisada pela proteína quinase Cdc2, que foi introduzida no Capítulo 7 (ver Figura 7.40) e será discutida em detalhes no Capítulo 14 como um regulador central da mitose. Cdc2 (assim como outras proteínas quinases ativadas em células mitóticas) fosforila todos os diferentes tipos de laminas, e o tratamento de núcleos isolados com Cdc2 mostrou ser suficiente para induzir a despolimerização da lâmina nuclear. Além disso, a necessidade de fosforilação da lâmina na quebra da lâmina nuclear foi demonstrada diretamente pela construção de lâminas mutantes que não podem mais ser fosforiladas. Quando os genes que codificam essas lâminas mutantes foram introduzidos nas células, sua expressão bloqueou a quebra normal da lâmina nuclear quando as células entraram na mitose.

Figura 8.31

Dissolução da lâmina nuclear. A lâmina nuclear consiste em uma rede de filamentos laminados. Na mitose, o Cdc2 e outras proteínas quinases fosforilam as lâminas, fazendo com que os filamentos se dissociem em dímeros de lâmina livre.

Em conjunto com a dissolução da lâmina nuclear, a membrana nuclear se fragmenta em vesículas (Figura 8.32). As laminas do tipo B permanecem associadas a essas vesículas, mas as laminas A e C se dissociam da membrana nuclear e são liberadas como dímeros livres no citosol. Esta diferença surge porque as laminas do tipo B são permanentemente modificadas pela adição de lípidos (grupos prenilo), enquanto os grupos prenilo do terminal C das lâminas do tipo A e C são removidos por proteólise a seguir à sua incorporação na lâmina. Os complexos de poros nucleares também se dissociam em subunidades como resultado da fosforilação de várias proteínas de poros nucleares. As proteínas integrais da membrana nuclear também são fosforiladas na mitose, e a fosforilação dessas proteínas pode ser importante na formação das vesículas, bem como na dissociação da membrana nuclear dos cromossomos e da lâmina nuclear.

Figura 8.32

Quebra da membrana nuclear. À medida que a lâmina nuclear se dissocia, a membrana nuclear se fragmenta em vesículas. As laminas do tipo B permanecem ligadas a essas vesículas, enquanto as laminas A e C são liberadas como dímeros livres.


Tamanho nuclear

O núcleo aumenta de tamanho desde o momento de sua formação, imediatamente após a montagem NE, até quando atinge seu tamanho final em interfase. Isso levanta a questão de o que controla o tamanho do nuclear: é uma mera consequência do aumento do volume ao longo do tempo, ou existem fatores que regulam ou limitam a expansão nuclear? Décadas de observações sugerem que o último é verdadeiro, e que os volumes nucleares e citoplasmáticos estão de alguma forma relacionados um ao outro, esse fenômeno é conhecido como razão carioplasmática (Gregory, 2005). Além disso, tanto nas leveduras de brotamento quanto nas de fissão, a proporção do volume nuclear para o celular permanece constante ao longo do ciclo celular, mesmo com o aumento do volume celular (Jorgensen et al., 2007 Neumann e Nurse, 2007). Isso sugere a existência de um mecanismo que liga os volumes nuclear e celular. Se de fato esse mecanismo existe, o volume celular dita o volume nuclear ou o volume nuclear determina o volume celular? Quais fatores celulares determinam o volume nuclear? E, finalmente, por que o volume nuclear é importante?

Variação na forma nuclear. Os núcleos da maioria das células, como os do C. elegans embrião (A), são ovais ou redondos. No entanto, vários tipos de células ou condições exibem núcleos não redondos. São mostrados os núcleos de neutrófilos (B), de células de um paciente com HGPS (C) e de células de um indivíduo de 96 anos (D, painel direito) em comparação com núcleos de células de um indivíduo de 9 anos (D, painel esquerdo). A visualização dos núcleos foi realizada com um componente NPC marcado com GFP, NPP-1 (A), um anticorpo específico para a lâmina B (B), um anticorpo específico para a emerina (uma proteína associada à lâmina, C) e um anticorpo específico para a lâmina A e lâmina C (D). A imagem em B foi reimpressa com permissão de Ada Olins e Donald Olins (Olins e Olins, 2005). A imagem em C foi reimpressa com permissão de Goldman (Goldman et al., 2004). As imagens em D foram fornecidas por Tom Misteli e Paola Scaffdi (NCI, Bethesda MD) (ver também Scaffidi e Misteli, 2006). Os núcleos não estão em escala.

Variação na forma nuclear. Os núcleos da maioria das células, como os do C. elegans embrião (A), são ovais ou redondos. No entanto, vários tipos de células ou condições exibem núcleos não redondos. São mostrados os núcleos de neutrófilos (B), de células de um paciente com HGPS (C) e de células de um indivíduo de 96 anos (D, painel direito) em comparação com núcleos de células de um indivíduo de 9 anos (D, painel esquerdo). A visualização dos núcleos foi realizada com um componente NPC marcado com GFP, NPP-1 (A), um anticorpo específico para a lâmina B (B), um anticorpo específico para a emerina (uma proteína associada à lâmina, C) e um anticorpo específico para a lâmina A e lâmina C (D). A imagem em B foi reimpressa com permissão de Ada Olins e Donald Olins (Olins e Olins, 2005). A imagem em C foi reimpressa com permissão de Goldman (Goldman et al., 2004). As imagens em D foram fornecidas por Tom Misteli e Paola Scaffdi (NCI, Bethesda MD) (ver também Scaffidi e Misteli, 2006). Os núcleos não estão em escala.

Fatores que afetam o volume nuclear

Existem relatos conflitantes sobre os fatores celulares dominantes que determinam o volume nuclear. Uma ideia, conhecida como teoria do nucleoesqueleto, é que o conteúdo do DNA influencia o volume do núcleo, que por sua vez influencia o tamanho da célula (Cavalier-Smith, 2005 Gregory, 2005). Intuitivamente, o DNA pode afetar o volume nuclear, porque o tamanho do núcleo pode ser diretamente proporcional à quantidade de DNA que ele contém e à extensão em que esse DNA é compactado. A simples comparação do tamanho do genoma com o volume nuclear e celular entre as espécies apóia essa teoria, porque espécies com genomas maiores geralmente têm volumes nucleares e celulares maiores (Cavalier-Smith, 2005 Jovtchev et al., 2006). Experimentos em camundongos também dão crédito à teoria nucleosqueletal: foi mostrado que embriões de camundongos tetraplóides têm núcleos que são duas vezes maiores do que aqueles em um controle diplóide (Henery et al., 1992 Henery e Kaufman, 1992).

No entanto, outros dados sugerem que o tamanho do genoma em si não é o fator determinante do tamanho do núcleo. Em vez disso, é provável que haja um mecanismo de escalonamento nuclear pelo qual o volume nuclear é proporcional e determinado pelos níveis de um ou mais fatores celulares. De fato, experimentos de transplante nuclear apoiam esta afirmação: implantar um pequeno núcleo de eritrócito de galinha em uma célula HeLa resulta na expansão do núcleo para o tamanho apropriado para seu novo ambiente, sem afetar o conteúdo de DNA (Harris, 1967). Além disso, a teoria do nucleoesqueleto não explica por que células de diferentes tecidos em um determinado organismo têm a mesma quantidade de DNA, mas tamanhos nucleares variados (Altman e Katz, 1976). Estudos em leveduras também contradizem a noção de que o conteúdo de DNA dita os volumes nucleares e celulares (Jorgensen et al., 2007 Neumann e Nurse, 2007). Nem na levedura de fissão nem na levedura de brotamento o volume nuclear aumenta acentuadamente durante a fase S, como seria de se esperar se o conteúdo de DNA tivesse um efeito direto no tamanho do núcleo (Jorgensen et al., 2007 Neumann e Nurse, 2007). Além disso, mesmo um aumento de 16 vezes na ploidia não afeta o tamanho do núcleo na levedura de fissão (Neumann e Nurse, 2007). Em vez disso, o deslocamento de núcleos por centrifugação em levedura de fissão multi-nucleada mostrou que o tamanho do núcleo se ajustou em proporção à quantidade de citoplasma circundante (Neumann e Nurse, 2007). Esses estudos apóiam um mecanismo pelo qual o tamanho do núcleo é determinado pelo volume citoplasmático ao invés do conteúdo de DNA.

Supondo que fatores citoplasmáticos determinem o tamanho do núcleo, quais seriam eles? Em extratos livres de células de Xenopus oócitos, um aumento no volume nuclear após a remontagem NE requer um ER intacto (Anderson e Hetzer, 2007). Isso sugere que a membrana para o NE recém-formado é fornecida pelo ER e, portanto, a disponibilidade da membrana pode ser um fator limitante na determinação do tamanho do núcleo. O ER existe como uma malha contínua de folhas de membrana e túbulos de membrana. Proteínas conhecidas como retículos causam a formação de túbulos no RE (Voeltz et al., 2006), e altos níveis de retículos são inibidores do crescimento nuclear, o que sugere que a disponibilidade de membrana na forma de folhas pode colocar um limite superior no tamanho do núcleo (Anderson e Hetzer, 2008 Kiseleva et al., 2007). Trabalho no Xenopus sistema demonstrou uma necessidade de NPCs e importação nuclear no crescimento nuclear após montagem NE (D'Angelo et al., 2006 Newport et al., 1990), o que sugere que a importação de uma ou mais proteínas nucleares contribui para o dimensionamento do núcleo. Na verdade, várias proteínas da lâmina nuclear que são transportadas para o núcleo através dos NPCs foram encontradas para afetar o crescimento nuclear de interfase (por exemplo, Brandt et al., 2006 Dittmer et al., 2007 Newport et al., 1990). No entanto, muitas questões permanecem. Por exemplo, como a levedura - que carece de laminas e proteínas associadas a laminas - ajusta o volume nuclear em resposta às mudanças no volume citoplasmático? Além disso, qual é o mecanismo, em qualquer organismo, que estabelece o limite superior para o crescimento nuclear?

O tamanho importa para a função nuclear?

Embora os mecanismos que controlam o volume nuclear permaneçam obscuros, a existência de uma razão carioplasmática sugere que o tamanho do núcleo é importante para a função celular. A perturbação desta proporção está associada a certos tipos de câncer (Slater et al., 2005 Zink et al., 2004), sugerindo que a proporção entre os volumes nuclear e citoplasmático é crucial para a integridade celular. Além disso, foi proposto que a progressão do ciclo celular depende do tamanho do núcleo (Roca-Cusachs et al., 2008 Yen e Pardee, 1979), e que as células monitoram a razão entre o volume citoplasmático e nuclear para avaliar o tempo adequado para entrar no ciclo celular (Futcher, 1996). Além disso, foi encontrada uma forte correlação entre o tamanho do núcleo, os níveis de transcrição do RNA e o tamanho da célula (por exemplo, Sato et al., 1994 Schmidt e Schibler, 1995). Portanto, é possível que núcleos maiores facilitem o aumento da transcrição que é necessário em células maiores. Além disso, o volume do núcleo pode ser importante para manter os compartimentos nucleares, como o nucléolo, e a atividade de enzimas como a DNA polimerase, que são sensíveis ao apinhamento macromolecular (Hancock, 2004 Miyoshi e Sugimoto, 2008 Sasaki et al., 2006). Uma visão cada vez mais popular da dinâmica molecular dentro do núcleo favorece a auto-organização de estruturas complexas - um processo que depende de interações bioquímicas e físicas entre inúmeras proteínas (Misteli, 2001). Um exemplo recente é a montagem de corpos de Cajal, que são estruturas nucleares envolvidas na biogênese de pequenas ribonucleoproteínas nucleares (snRNPs). Os corpos de Cajal se reúnem por auto-organização por meio de interações estocásticas entre os blocos de construção de que são compostos (Kaiser et al., 2008 Misteli, 2008). Como a auto-organização pode ser extremamente sensível à concentração dos componentes individuais, a regulação do volume nuclear pode ter um papel importante em possibilitar esse processo.


Antes de começar, é sempre importante garantir que a superfície de trabalho esteja limpa e que você esteja usando um par de luvas limpas para evitar contaminação.

As células da bochecha podem ser facilmente obtidas raspando suavemente o interior da boca com um cotonete limpo e esterilizado.

Uma vez que as células foram obtidas, o seguinte procedimento é usado para célula da bochecha preparação para montagem úmida:

  1. coloque uma gota de soro fisiológico em uma lâmina microscópica limpa (parte central da lâmina)
  2. passe o cotonete no centro (parte que contém a gota de soro fisiológico) da lâmina limpa por cerca de 4 segundos para colocar as células no centro da lâmina
  3. adicione uma gota de solução de azul de metileno no esfregaço e coloque delicadamente uma lamela por cima (para cobrir a mancha e as células)
  4. qualquer solução em excesso pode ser removida tocando um lado da lâmina com uma toalha de papel ou papel absorvente.
  5. coloque a lâmina no microscópio para observação usando objetiva 4 x ou 10 x para encontrar as células
  6. uma vez que as células foram encontradas, elas podem ser vistas em maior magnificatio

* Observação - Cotonetes e toalha de algodão usados ​​devem ser descartados com segurança no lixo e não deixados sobre a mesa de trabalho.

Por que temos que manchar as células?

A célula tem diferentes partes e aquelas que podem absorver manchas ou corantes são chamadas de cromáticas. Tendo absorvido a mancha, essas partes da célula se tornam mais visíveis ao microscópio e podem, portanto, ser facilmente distinguidas de outras partes da mesma célula.

Sem manchas, as células pareceriam quase transparentes, dificultando a diferenciação de suas partes.

O azul de metileno tem uma afinidade de cadeia para DNA e RNA. Ao entrar em contato com os dois, uma mancha mais escura é produzida e pode ser visualizada ao microscópio.

O núcleo na parte central da célula da bochecha contém DNA. Quando uma gota de azul de metileno é introduzida, o núcleo fica manchado, o que o faz se destacar e ser visto claramente ao microscópio.

Embora toda a célula apareça na cor azul claro, o núcleo na parte central da célula é muito mais escuro, o que permite sua identificação.


Temperatura

Algumas espécies, como lagartos, mariposas, pássaros e platelmintos, têm genes de determinação de sexo diferentes de X e Y. Esses genes são Z e W. O genótipo ZZ produz machos e o ZW produz fêmeas. A determinação do sexo em algumas dessas espécies é dirigida pela temperatura. Sabe-se que altas temperaturas ditam o sexo do animal. Por exemplo, altas temperaturas de incubação para ovos de crocodilo promovem genótipos machos, ZZ. No entanto, em muitos lagartos e tartarugas, as altas temperaturas de incubação favorecem o genótipo feminino, ZW.


Como ver o DNA com o olho nu

O DNA, ou ácido desoxirribonucléico, está contido em todos os organismos vivos e é o conjunto de instruções que dizem a uma célula como construir uma proteína. No corpo humano, o DNA diz ao corpo como construir proteínas que compõem o cabelo, a pele, os músculos e todos os órgãos do corpo.

O DNA é armazenado no núcleo das células. É uma molécula extremamente fina com média de cerca de 2 nanômetros de largura. Um nanômetro é um bilionésimo de um metro. Para colocar isso em perspectiva, um cabelo humano tem aproximadamente 80.000 nanômetros de largura.

Nesta atividade, você extrairá DNA de ervilhas verdes divididas. Para fazer isso, você passará por uma série de etapas que incluem quebrar a célula, liberar o DNA do núcleo e proteger o DNA de enzimas que irão cisalhá-lo ou quebrá-lo.

Ao realizar esta atividade, pense por que está realizando cada uma das etapas. Finalmente, explique como você será capaz de ver o DNA quando ele é 40.000 vezes menor que um fio de cabelo humano.

Nesta atividade iremos:

  • Extraia o DNA de ervilhas verdes e observe a olho nu
  • Analise as etapas realizadas para extrair os materiais de DNA
  • Despeje a porção líquida da mistura através da peneira em uma tigela de tamanho médio. Não despeje pedaços de ervilhas verdes não misturadas na tigela.
  • Adicione 2 colheres de sopa de detergente de louça à tigela e mexa delicadamente por 2 minutos.
  • Deixe a mistura definir por aproximadamente 5 minutos.
  • Despeje parte desta solução em um pequeno copo transparente enchendo o copo apenas pela metade.
  • Adicione uma pitada de amaciante de carne ao líquido no copo pequeno transparente e mexa por 15 segundos.
  • Remova o máximo possível de bolhas da solução com uma toalha de papel. Quanto menos bolhas na xícara, melhor o DNA será visto.
  • Despeje lentamente o álcool isopropílico frio no copo pequeno e transparente até que esteja quase cheio. Despeje o álcool o mais delicadamente possível tentando não perturbar a mistura que já está no pequeno copo transparente.
  • Observe a mistura branca, fibrosa e espumosa no vidro - esse é o seu DNA! Você pode precisar deixar a solução definir por vários minutos antes que o DNA se torne visível.

Materiais

  • 1/2 xícara de ervilhas verdes (não ilustradas)
  • copo de medição
  • pitada de sal de cozinha
  • detergente de louça
  • amaciante de carne
  • liquidificador
  • pequeno vidro transparente
  • filtro
  • tigela de tamanho médio
  • 1 xícara de água
  • álcool isopropílico frio 90% ou superior
  • colher de sopa

Segurança

Esta atividade requer o uso de um liquidificador com lâminas afiadas. Tenha cuidado ao usar um liquidificador. Nunca coloque a mão no liquidificador e coloque uma tampa no liquidificador ao misturar. Peça a um adulto para ajudá-lo, se necessário.

Preparação

  • Coloque o álcool isopropílico na geladeira ou freezer cerca de 1 hora antes de realizar a atividade.
  • Reúna todos os outros materiais.

Atividade

  • Coloque ½ xícara de ervilhas verdes, 1 xícara de água e uma pitada de sal no liquidificador.
  • Misture em alta por aproximadamente 20 segundos.

Atividade de extensão

  • Enzimas de pesquisa para descobrir por que o amaciante de carne é um ingrediente necessário na extração de DNA.
  • Tente extrair DNA de outras frutas ou vegetais.

Embrulhar
Após esta atividade, você deve conhecer os passos necessários para extrair DNA de ervilhas verdes partidas. Você também deve entender o objetivo de cada etapa. A combinação quebra a célula, o sabão e o sal liberam o DNA do núcleo, o amaciante de carne evita que as enzimas quebrem o DNA e o DNA não é solúvel em álcool, então ele precipita na fronteira entre a água e o álcool. Você também pode tentar extrair DNA de outras frutas ou vegetais. Você verá que certas frutas e vegetais produzirão mais ou menos DNA. Finalmente, você deve entender que o DNA que você está vendo não são fitas individuais, mas uma massa emaranhada de todo o DNA que está presente no núcleo de uma célula.


Boa sorte escrevendo o exame simulado !!

Aplicação do exame simulado: sexta-feira, 8 de dezembro, das 6h às 21h (MC 2000)

Horário comercial extra: quarta-feira, 6 de dezembro, das 14h às 16h (402 ML)

A menos que especificado de outra forma, assume uma variedade independente

De que forma as células são capazes de diminuir sua fluidez de membrana? uma. Aumentando o nível de colesterol na membrana b. Aumentando o número de gorduras insaturadas na membrana c. Aumentando o número de fosfolipídios nas membranas d. Aumentando o número de gorduras saturadas na membrana e. Ao aumentar o número de proteínas na membrana

Na reação seguinte, a molécula de carbono da glicose deve formar dióxido de carbono e a molécula de oxigênio deve formar água.

C 6 H 12 O 6 + 6 O 2 6 CO 2 + 6 H 2 O + Energia

uma. oxidado, reduzido b. reduzido, oxidado c. oxidado, oxidado d. reduzido, reduzido e. Esta não é uma reação REDOX.

Um pêssego azul geneticamente modificado tem o genótipo BB e é autossômico dominante. Os pêssegos recessivos desta variedade são roxos. Outro gene no pêssego o torna branco quando autossômico recessivo. Como é conhecida essa interação? uma. Pleiotropia b. Epistasia c. Aneuploidy d. Dominância incompleta e. Codominância

Qual das opções a seguir pode se difundir facilmente através da membrana? uma. Glicose b. Íons de hidrogênio c. Metano d. Íons de potássio e. Sacarose

Qual é o produto final do ciclo de Calvin? uma. Bifosfoglicerato b. Piruvato c. Dióxido de carbono d. Fosfato de gliceraldeído e. Oxaloacetato

Que tipo de ligação se forma entre pares de bases complementares? uma. Ligações iônicas b. Ligações de hidrogênio c. Ligações covalentes d. Ligações dissulfeto e. Ligações peptídicas

Rachel e Ross acabaram de se casar. Ross foi casado uma vez e teve um filho albino. Rachel tem uma irmã albina. Nem Ross, Rachel ou qualquer um de seus pais são albinos. Calcule a probabilidade de Ross e Rachel terem um filho albino. O albinismo é um transtorno autossômico recessivo. uma. 1 / b. 1 / c. 1 / d. 2 /

Quantos tipos diferentes de gametas poderiam ser produzidos por meio de classificação independente por um indivíduo com um genótipo AA Bb Cc DD Ee? uma. 5 b. 6 c. 8 d. 16 e. 64

Use o seguinte pré-decreto para responder às perguntas 15 e 16:

Qual das alternativas a seguir descreve melhor a doença no pedigree acima? uma. Dominante ligado ao X b. X-link recessivo c. Dominante autossômico d. Autossômica recessiva e. Y-link

No pedigree acima, qual é o genótipo mais provável do macho de primeira geração? uma. HH b. Hh c. hh d. XhY e. Ou a ou B

Em um cruzamento entre uma mosca-das-frutas fêmea de olhos brancos e um macho de olhos vermelhos, que porcentagem da prole fêmea terá olhos brancos? (Olhos brancos são ligados ao X, recessivos) a. 100% b. 75% c. 50% d. 25% e. 0%

Uma Drosophila fêmea de genótipo desconhecido foi cruzada com uma mosca macho de olhos brancos, de genótipo (w = alelo de olho branco é recessivo, w + = alelo de olho vermelho é dominante.) Metade dos filhotes do sexo masculino e metade da fêmea eram vermelhos olhos, e metade dos filhotes machos e metade das fêmeas tinham olhos brancos. Qual era o genótipo da mosca fêmea? uma. Xw Y b. Xw Xw c. Xw + Xw d. Xw + Xw + e. Xw + Y

A hemofilia em humanos é causada por uma mutação no cromossomo X. Quais serão os resultados do acasalamento entre uma fêmea normal (não portadora) e um macho hemofílico? uma. 50% dos filhos são hemofílicos, 50% das filhas são hemofílicos b. 100% dos filhos são hemofílicos c. 100% das filhas são hemofílicas d. 50% dos filhos são normais, 50% dos filhos são hemofílicos e 100% das filhas são portadoras e. 100% das filhas são portadoras, 100% dos meninos são normais

  1. Uma reação ocorre quando um dissacarídeo é formado a partir de dois monossacarídeos. uma. Desidratação b. Oxidação c. Hidrólise d. Redução e. Interação hidrofílica
  1. O alelo P dominante de um gene que controla a cor em flores de ervilha produz pétalas com uma cor roxa

plantas coloridas homozigotas para um alelo p recessivo desse gene têm flores brancas. If a Pp plant and a Pp plant were crossed, what would be the expected phenotypic ratios of the offspring? uma. 2 purple: 2 white b. 1 purple : 3 white c. 3 purple: 1 white d. 3 white: 1 purple e. 4 purple: 0 white

uma. Metaphase chromosome b. Nucleosome c. DNA double helix d. Looped domains e. 30 nm chromatin fibre

  1. Which of the following statements describes the concept of “semi-conservative” DNA replication? uma. The two parental strands reassociate after acting as templates for new strands, thus restoring the parental double helix. b. Each strand of both daughter molecules contains a mixture of old and newly synthesized DNA. c. The two strands of the parental molecule separate, and each functions as a template for synthesis of a new, complementary strand. d. DNA Polymerase III carries out synthesis by extending from the RNA primer (5’ to 3’) e. That the lagging strand of DNA is synthesized in short fragments called Okazaki fragments.

Use the following information to answer questions 32 through 34. The following sequence represents a non-transcribed strand of a gene. The transcription initiation sequence is at the first underlined T. There are introns present in between, but not including the first underlined C and second underlined T and another between but not including the underlined A and third underlined T.

5’ -GGCTTUTGTGGTATGTCATACAATTGGGCGGAGGATTTCCACATTTGTGGAGGGGTAGGCATGCC

GGTTAAAGGCCCTTAGAGTTAT – 3’

  1. What would the transcribed mRNA strand leaving the nucleus look like? uma. 5’ - G UGGUGUUAUUGAUAGAUGGGGAGGUGUUACACUCUA AAAAAAAA - 3’ b. 3’ – G UGUGGUAUGUCAUACUGUGGAGGGGUAUAGAGUUAU AAAAAAA – 5’ c. 5’ – G UGUGGUAUGUCAUACUGUGGAGGGGUAUAGAGUUAU AAAAAAA – 3’ d. 5’ – TGTGGTATGTCATACTGTGGAGGGGTATAGAGTTAT – 3’ e. 5’ – G UGUGGAUAGCAUGCCUUAAGUCCAUGCCUUAGCGUAU AAAAAAA – 3’

What would the translated protein sequence of the above mRNA strand look like? (genetic code on last page) a. Met - Ser – Ser –Tyr – Gly – Val – His b. Met – Ser - Tyr – Cys – Gly – Gly – Val c. Gly – Cys – Met – Ser – Tyr – Cys – Gly – Gly – Val d. Gly – Ser – His – Val – Leu – Ile – Val e. Val – Gly – Leu – Trp – Cys – Ser – Gly – Gly – Val

If the underlined A was replaced with a C what would the resulting mutation be? uma. No mutation would occur b. Frameshift c. Nonsense d. Silent e. Missense

The tortoiseshell coat present on some female cats is the result of? uma. Incomplete dominance b. Polygenic inheritance c. X-inactivation d. Y-inactivation e. Codominância

In the fruit fly, the dominant and recessive traits for body colour and wing size are as follows:

Character Wild Type Mutant Body Colour Grey (b+) Black (b) Wing Size Normal (vg+) Vestigial (vg)

The genes encoding body colour and wing size are linked. A wild-type fruit fly, heterozygous for grey body colour and normal wings, was bred with a black fruit fly with vestigial wings. The distribution of the offspring is as follows: 437 black with normal wings, 752 grey with normal wings, 263 grey with vestigial wings and 548 black with vestigial wings. What is the recombination frequency between the genes for the body colour and wing size? uma. 15% b. 30% c. 35% d. 70% e. There is no recombination

  1. How many centimorgans away from each other are the above loci? uma. 60 b. 66 c. 35 (I think. Double-check) d. 70 e. 100

Which of the following statements is true about polyploidy? uma. It alters the genetic balance. b. Includes traits such as height and skin colour. c. Occurs when an organism had more than the diploid set of chromosomes. d. It appears as a bell curve in the population. e. b and d are both correct

If you have a plant with blue flowers and round seeds, Bb Rr, crossed with a plant with white flowers and round seeds, bb Rr, what is the probability of getting a plant with blue flowers and wrinkled seeds? uma. 1/ b. 1/ c. 1/ d. 3/ e. 1/

Which of the following is a source of genetic variability in meiosis? uma. Independent Assortment b. Transformation c. Recombination d. Random fertilization e. a, c and d are correct

What is required to regenerate RuBP in phase 3 of the Calvin Cycle? uma. 1 G3P, 9 ATP, 6 NADPH b. 5 G3P, 3 ATP c. 5 G3P, 9 ATP, 6 NADPH d. 1 G3P, 3 ATP e. 6 G3P, 3 AT

A plant that is heterozygous for the dominant “purple” colour is crossed with a plant that is recessive for the “white” colour. In the F1 generation, 150 plants are purple. Approximately how many plants in the F1 generation are expected to be white? uma. 150 b. 25 c. 50 d. 0 e. More information is required to answer the question

Which of the following statements about meiosis 1 is false? uma. During anaphase 1 homologous chromosomes are pulled to opposite poles b. During prophase 1 chromosomes condense c. Synapsis occurs during prophase 1 d. Separation of the cytoplasm occurs during anaphase 1 e. No replication occurs after meiosis 1

You have a purple, tall plant with yellow, round seeds, Pp TT Yr Rr crossed with a white, dwarf plant with yellow, wrinkled seeds, pp tt Yy rr. What is the probability of getting a purple tall plant with yellow wrinkled seeds? uma. 1/ b. 3/ c. 3/ d. 1/ e. 0

Which of the following bridges the enhancer and the promoter? uma. Activators b. Co-Activators c. Repressors d. General transcription factors e. Enhancer

Which of the following is true about recombination frequency? uma. Genes that are closer together have a higher rate of recombination b. Genes that are further apart have a higher rate of recombination c. All genes recombine at the same frequency d. Genes with a recombination frequency equal to 1 assort independently e. Nenhuma das acima

What did the Frye-Edidin experiment demonstrate? uma. The membrane proteins are unable to move within the plane of the plasma membrane. b. That some membrane proteins move sideways within the plane of the plasma membrane. c. That phospholipids can “flip-flop” across the plasma membrane. d. That phospholipids cannot move sideways within the plane of the plasma membrane. e. None of the above.

Red-green colour blindness is a recessive, X-linked condition. A normal-vision daughter of a man with red-green colour blindness marries a man who is also normal for the trait. If the couple has two sons, what is the probability that both sons will be born with red-green colour blindness? uma. 1/ b. 1/ c. 1/ d. 1/ e. 0

Which of the following statements is true of the lac operon?

uma. It operates when glucose is present but only if there is an absence of lactose b. It operates when lactose is present but only if there is an absence of glucose c. Expression will occur when an inducer binds to the repressor protein d. a and c are both true e. b and c are both true

Which of the following statements regarding protein synthesis is true? uma. Transcription involves the transfer of information from DNA to RNA, and translation involves the transfer of information from RNA to amino acids b. Transcription involves the transfer of information from DNA to RNA, and translation involves the transfer of information from DNA to amino acids c. Transcription uses nucleic acids exclusively to transfer information, while translation exclusively uses protein monomers. d. Transcription involves the transfer of information from DNA to RNA, while translation only uses RNA e. Options A and C are both correct

A difference between translation initiation in prokaryotes and eukaryotes is. uma. In prokaryotes translation begins at the first start codon in the RNA strand, and in eukaryotes translation occurs at the first start codon that the ribosomal subunit encounters. b. In eukaryotes translation begins at the first start codon in the RNA strand, and in prokaryotes translation occurs at the first start codon that the ribosomal subunit encounters. c. Prokaryotes and Eukaryotes have unique start and stop codons. d. In prokaryotes translation is right to left and in eukaryotes translation is left to right. e. There are no differences in translation between prokaryotes and eukaryotes.

Why can C3 plants not survive in hot and dry climates? uma. They undergo photorespiration b. They undergo phosphorespiration c. They do not have advanced control over their stomata like C4 and CAM plants d. They cannot get enough oxygen e. Their leaves are too big and would get dried out

Why is a testcross be performed? uma. To determine the phenotype(s) of an organism’s offspring b. To determine the genotype(s) of an organism’s offspring c. To determine the traits expressed by an organism d. To determine the genotype of an organism e. To determine which traits are dominant and which are recessive

John has hemophilia, but his daughter Lucy does not. Lucy marries a man with hemophilia named Paul. If Lucy and Paul have two daughters and one son, what is the probability that none of their children will be affected by the disease? (Note that hemophilia is an X-linked recessive trait) a. 1/ b. 1/ c. 1/ d. 3/ e. 1

To what area of genetics did Gregor Mendel contribute the most? uma. Determining the dominant and recessive traits in pea plants b. Discovering the basic patterns of allele sorting into gametes during meiosis c. Discovering the principles of incomplete dominance in flowers d. Creating the Punnett square method to calculate possible genotypes e. Generating interest in the field to entice future researchers

The allele R codes for red flowers and r for white flowers. This species displays incomplete dominance for colour resulting in pink flowers. The allele E codes for rough edges and the allele e for smooth edges. If a pink individual with smooth edges is crossed with a pink individual that is heterozygous for edge shape, what proportion of the offspring will display a pink phenotype? uma. 0% b. 25 % c. 50 % d. 75 % e. 100 %

Mendel finds a stray green pea plant and performs a testcross. He discovers that all of the resulting offspring are green. What are the genotypes of the parents in this cross? uma. GG x GG b. GG x Gg c. Gg x Gg d. gg x Gg e. gg x GG

What important contribution did Thomas Hunt Morgan make to genetics? uma. He discovered that many traits are not segregated independently b. He determined the karyotype of drosophila c. He coined the term genetics d. He discovered that fruit flies have red and white eyes e. Options A and C are both correct

When a gene has more than two allelic forms, it can be referred to as. uma. Incomplete dominance b. Codominance c. Multiallelism d. Multiple alleles e. Dominant and recessive alleles

Which of the following statements regarding polygenic inheritance is false? uma. Several genes work together to influence a specific trait b. Produced phenotypes are displayed as a blend of many different alleles c. Polygenic inheritance is the same as incomplete dominance d. Produced phenotypes exist on a continuum and follow a bell-shaped curve e. All of these statements are true

What is the probability that an offspring will have the genotype: aaBbDDEe? uma. 1/ b. 1/ c. 1/ d. 3/ e. 3/

What is most likely the inheritance pattern shown in the pedigree? uma. Autosomal recessive b. Autosomal dominant c. X-linked dominant d. X-linked recessive e. Y-linked

What is the probability that the offspring from the individual 5IV will possess the trait? (Assuming an unaffected partner.) a. 0 b. 1/ c. 1/ d. 3/ e. Impossible to determine

In a sample of 1000 progeny, how many must vary, phenotypically, from the parental phenotypes for the alleles in question to be deemed unlinked? uma. 250 b. 500 c. 600 d. 750 e. More information is needed to answer this question.

What type of inheritance pattern is shown by skin colour and height? uma. Natural selection b. Incomplete dominance c. Codominance d. Polygenic inheritance e. Blending inheritance

Answer is 1/8 which was forgotten here

A certain flower variety shows phenotypes of red, white, and pink petal colours with smooth or rough petal edges. Red and rough are both dominant alleles. A cross was performed with a parent that was heterozygous for both traits and a parent that was homozygous recessive for both traits. If an offspring with pink, smooth petals is crossed with an offspring that has white, rough petals, what will the phenotype ratio be for the second-generation offspring? uma. 1:2: b. 9:3:3: c. 6:3:3: d. 6:6:3: e. 1:1:1:

BONUS: Have you filled out the feedback survey about PASS? You could win a gift certificate! uma. Sim! b. Not yet, but I will!


What does the nucleus look like in S phase of Meiosis? - Biologia

Tagging expressed proteins with the green fluorescent protein (GFP) from Aequorea victoria[1] is a highly specific and sensitive technique for studying the intracellular dynamics of proteins and organelles. We have developed, as a probe, a fusion protein of the carboxyl terminus of dynein and GFP (dynein–GFP), which fluorescently labels the astral microtubules of the budding yeast Saccharomyces cerevisiae. This paper describes the modifications to our multimode microscope imaging system [2], [3], the acquisition of three-dimensional (3-D) data sets and the computer processing methods we have developed to obtain time-lapse recordings of fluorescent astral microtubule dynamics and nuclear movements over the complete duration of the 90–120 minute yeast cell cycle. This required low excitation light intensity to prevent GFP photobleaching and phototoxicity, efficient light collection by the microscope optics, a cooled charge-coupled device (CCD) camera with high quantum efficiency, and image reconstruction from serial optical sections through the 6 µm-wide yeast cell to see most or all of the astral molecules. Methods are also described for combining fluorescent images of the microtubules labeled with dynein–GFP with high resolution differential interference contrast (DIC) images of nuclear and cellular morphology [4], and fluorescent images of the chromosomes stained with 4,6-diamidino-2-phenylindole (DAPI) [5].

SL Shaw, E Yeh, K Bloom and ED Salmon, Department of Biology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-3280, USA.

E-mail address for ED Salmon (corresponding author): [email protected] .


Assista o vídeo: AS FASES DA MITOSE EU SEI DE COR. PARÓDIA DE BIOLOGIA Marília Mendonça - Eu Sei de Cor. BioloHits (Agosto 2022).