Em formação

Diferença de cobertura entre amplicons

Diferença de cobertura entre amplicons



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Eu tenho 2 arquivos fastq e gerei um arquivo BAM (indexado e classificado) de algumas leituras. Eu os alinhei a um genoma de referência (hg19).

Estou trabalhando com diferentes primers.

FRENTE 1. TTGCCAGTTAACGTCTTCCTTCTCTCTCTG 2. CCCTTGTCTCTGTGTTCTTGTCCCCCCCA 3. TGATCTGTCCCTCACAGCAGGGTCTTCTCT 4. CACACTGACGTGCCTCTCCCTCCCTCCA REVERSE 1. GAGAAAAGGTGGGCCTGAGGTTCAGAGCCA 2. CCCCACCAGACCATGAGAGGCCCTGCGGCC 3. TGACCTAAAGCCACCTCCTTA 4. CCGTATCTCCCTTCCCTGATTA

Portanto, tenho diferentes amplicons. Como posso traçar a cobertura desses diferentes amplicons. E o que poderia explicar a grande diferença entre eles?

Muito obrigado por sua ajuda.


Bem, para traçar a cobertura, eu usaria algo como Python Matplotlib. Dê uma olhada neste exemplo:

import matplotlib.pyplot as plt import matplotlib amplicons = ('TTGCCAGTTAACGTCTTCCTTCTCTCTCTG', 'CCCTTGTCTCTGTGTTCTTGTCCCCCCCA', 'TGATCTGTCCCTCACAGCAGGGTCTTCTFCTFCTGTCTGTGTTCTTGTGTCTCTGTGTTCTTGTCCCTGTGTTCTTGTCCCTGTGTGTTCTTGTCCCT,' (figtCCCTTFIG 56,834.5) (figtCCCTTFIG 568348 Figura 5, figt. )) subplt = fig.add_subplot (111) subplt.set_ylabel ('Count') subplt.set_xlabel ('Amplicons') subplt.plot (amplicons, countAmpl, linestyle = "-", marker = "o", color = "blue ") para tl em subplt.get_yticklabels (): tl.set_color ('blue') plt.savefig (" amplicons.eps ")

Verifique outros tipos de gráficos no Matplotlib se você acha que precisa de algo mais.

Você também pode tentar abrir e visualizar o BAM no IGV do Broad Institute.

Em relação à diferença de cobertura, diria que alguns são de uma região repetitiva. Ou a profundidade de amplificação de uma região é maior do que para as outras. Ou talvez o alinhador encontrou regiões semelhantes e decidiu que o amplicon se alinha bem em todas essas regiões.


O BEDTools, entre outros pacotes de software, fornecerá um histograma de cobertura. A maior fonte de polarização na eficiência da PCR é apenas que alguns primers funcionam melhor do que outros, há polarização de sequência no estágio de amplificação da PCR da preparação da biblioteca também. O conteúdo do GC contribui para isso.


Abordagens de sequenciamento direcionado para NGS

Embora o sequenciamento do genoma humano completo tenha avançado na descoberta e na saúde humana, regiões desafiadoras do genoma são difíceis de analisar usando esta abordagem, resultando em um viés de sequenciamento da população, e os bancos de dados existentes não são completos nem precisos (1). Para muitas aplicações de pesquisa, o custo do sequenciamento do genoma completo ainda pode ser um fardo, especialmente quando você leva em consideração as necessidades de processamento computacional e informática para a análise do genoma completo. Esse custo e complexidade adicionais seriam de poucos benefícios ao estudar uma região específica de interesse para doenças e aplicações de pesquisa translacional. Para ajudar a resolver esse problema, muitos pesquisadores adotaram uma abordagem de sequenciamento direcionado para melhorar a cobertura, simplificar a análise e interpretação e reduzir seus custos totais de fluxo de trabalho de sequenciamento.


Em primeiro lugar, as regiões alvo de um genoma ou amostra de DNA são amplificadas por iniciadores de PCR multiplex bem projetados com caudas salientes sendo sequências adaptadoras parciais compatíveis com os sequenciadores de DNA correspondentes, resultando em amplicons alvo e produtos de PCR não específicos, incluindo dímeros de iniciador.

Tradicionalmente, quando o tamanho do painel é grande (por exemplo, mais de 2.000 amplicons em um único pool), os produtos de PCR não específicos podem ser opressores e afetar significativamente as etapas a jusante se não houver medida para removê-los. Alguns métodos baseados em amplicon utilizam purificação de grânulos e seleção de tamanho para remover fragmentos de DNA menores, como dímeros de primer. No entanto, alguns produtos de PCR não específicos complicados com tamanhos semelhantes aos comprimentos dos amplicons alvo e suas bibliotecas resultantes podem ser difíceis de remover usando apenas a seleção de tamanho. O seguinte traçado do Bioanalyzer mostra um ruído de fundo significativo em torno de uma biblioteca alvo de 300 bp.

/> Rastreamento de biblioteca CleanPlex sem limpeza de fundo

O CleanPlex supera essa desvantagem com uma etapa de limpeza de fundo enzimática / química inovadora e patenteada que remove produtos de PCR não específicos, incluindo dímeros de primer e artefatos de PCR não específicos mais complicados e longos, resultando em bibliotecas alvo muito puras. O seguinte traçado do Bioanalyzer mostra o efeito da tecnologia de limpeza de fundo CleanPlex.

/> Rastreio de biblioteca CleanPlex com limpeza de fundo

Posteriormente, códigos de barras de amostra (para fins de agrupamento de amostra) são adicionados por uma etapa de PCR de indexação para obter bibliotecas prontas para sequenciamento. Todo o fluxo de trabalho leva apenas 3 horas e o mínimo de tempo prático.


Avaliação do painel Precision ID Ancestry

A capacidade de fornecer inteligência forense baseada em DNA precisa da análise de vários marcadores de DNA para prever a ancestralidade biogeográfica (BGA) e as características externamente visíveis (EVCs) do doador de evidências biológicas. O sequenciamento massivamente paralelo (MPS) permite a análise de centenas de marcadores de DNA em várias amostras simultaneamente, aumentando o valor da inteligência fornecida aos investigadores forenses enquanto reduz o esgotamento do material probatório resultante de análises múltiplas. O Precision ID Ancestry Panel (anteriormente o HID Ion AmpliSeq ™ Ancestry Panel) (Thermo Fisher Scientific) (TFS)) consiste em 165 SNPs autossômicos selecionados para inferir BGA. Os critérios de validação forense foram aplicados a 95 amostras usando este painel para avaliar a sensibilidade (1 ng-15 pg), reprodutibilidade (variabilidade inter e intra-execução) e efeitos de amostras do tipo de caso forense comprometidas e forenses (artificialmente degradadas e inibidas, fonte mista e amostras de sangue e ossos envelhecidos). A precisão da predição BGA foi avaliada usando amostras de indivíduos que declararam sua ascendência como sendo de populações únicas de origem (n = 36) ou de múltiplas populações de origem (n = 14). O sequenciamento foi conduzido em chips Ion 318 ™ (TFS) no Sistema Ion PGM ™ (TFS). O software HID SNP Genotyper v4.3.1 (TFS) foi usado para realizar previsões BGA com base em proporções de mistura (nível continental) e estimativas de probabilidade (nível de subpopulação). A predição de BGA foi precisa em quantidades de modelo de DNA de 125pg e 30pg usando 21 e 25 ciclos de PCR, respectivamente. As atribuições de BGA de nível continental HID SNP Genotyper foram concordantes com BGAs para indivíduos autodeclarados do Leste Asiático, Africano, Europeu e do Sul da Ásia. Amostras comprometidas, de origem mista e mista, além da previsão do nível de subpopulação, requerem uma análise mais extensa.

Esta é uma prévia do conteúdo da assinatura, acesso por meio de sua instituição.


Resumo

A fenotipagem forense pode fornecer informações úteis sobre a ancestralidade biogeográfica (BGA) e as características externamente visíveis (EVCs) do doador de uma amostra probatória. Atualmente, a inferência baseada em polimorfismo de nucleotídeo único (SNP) de BGA e EVCs é realizada mais comumente usando SNaPshot ®, um ensaio de extensão de base única (SBE). No entanto, um único PCR multiplex SNaPshot é limitado a 30–40 SNPs. O sequenciamento de próxima geração (NGS) oferece o potencial de genotipar centenas a milhares de SNPs de várias amostras em uma única execução experimental. Os multiplexes de PCR de cinco ensaios SNaPshot (SNPparaID 52plex, SNPparaID 34plex, Eurasiaplex, IrisPlex e um ensaio BGA não publicado) foram aplicados a três diferentes quantidades de molde de DNA (0,1, 0,2 e 0,3 ng) em três amostras (DNAs controle 9947A e 007 e um doador masculino). Os amplicons de PCR agrupados contendo 136 SNPs únicos foram sequenciados usando o sistema Ion Torrent ™ PGM da Life Technologies. Aproximadamente 72 Mb de sequência foram gerados a partir de dois chips Ion 314 ™ v1 de 10 Mb. Genótipos precisos foram prontamente obtidos de todas as três quantidades de modelo. De um total de 408 genótipos, 395 (97%) eram totalmente concordantes com SNaPshot em todas as três quantidades de modelo. Desses genótipos discordantes com SNaPshot, seis sequências Ion Torrent (1,5%) eram totalmente concordantes com o sequenciamento Sanger nas três quantidades de modelo. Sete SNPs (1,7%) foram discordantes entre as quantidades do modelo ou discordantes com o sequenciamento de Sanger. A cobertura de sequência observada no controle negativo e a variação de cobertura de alelo para genótipos heterozigotos destaca a necessidade de estabelecer um limite para níveis de fundo de produção de sequência e equilíbrio heterozigoto. Este estudo preliminar do sistema Ion Torrent PGM demonstrou um potencial considerável para uso em análises forenses de DNA como uma plataforma NGS de baixo a médio rendimento usando ensaios SNaPshot estabelecidos.


Polimerases de DNA de alta fidelidade Q5 e reg

A polimerase de DNA de alta fidelidade Q5 e reg (NEB # M0491) define um novo padrão para fidelidade e desempenho robusto. Com a amplificação de maior fidelidade disponível (& gt280 vezes maior do que Taq), A polimerase de DNA Q5 resulta em taxas de erro ultrabaixas. A Q5 DNA Polymerase é composta por uma nova polimerase que é fundida ao domínio de ligação ao DNA Sso7d, que aumenta a processabilidade, melhorando a velocidade, a fidelidade e a confiabilidade do desempenho. As master mixes Q5 contêm dNTPs, Mg ++ e um buffer proprietário de amplo uso que requer apenas a adição de primers e modelo de DNA para amplificação robusta, independentemente do conteúdo de GC.

NOVO: Polimerase de DNA de alta fidelidade Q5U Hot Start (NEB # M0515). Q5U é uma versão modificada da polimerase de DNA de alta fidelidade Q5 contendo uma mutação no bolso de ligação de uracila que permite a capacidade de ler e amplificar modelos contendo bases de uracila e inosina. Isso é útil para amplificar DNA convertido por bissulfito, desaminado enzimaticamente ou danificado, evitando contaminação por carreamento em PCR (quando usado com dUTP e UDG) e em métodos de clonagem de USUÁRIO. Aprenda mais sobre este produto.

Comparação de polimerases de alta fidelidade

1 Continuamos a investigar ensaios aprimorados para caracterizar Q5 & rsquos taxa de erro muito baixa para garantir que apresentamos os dados de fidelidade mais precisos possíveis (Potapov, V. e Ong, J.L. (2017) PLoS ONE. 12 (1): e0169774).
2 Triagem de mutação baseada em PCR em lacI (Agilent) ou rpsL (Life).

Vantagens

  • Amplificação de maior fidelidade (& gt280X maior que Taq)
  • Taxas de erro ultrabaixas
  • Desempenho superior para uma ampla gama de amplicons (de alto AT a alto GC)
  • Formatos de hot start e master mix disponíveis

O sistema de buffer Q5 é projetado para fornecer desempenho superior com otimização mínima em uma ampla gama de amplicons, independentemente do conteúdo do GC. Para amplicons de rotina ou complexos até

Conteúdo de GC de 65%, o tampão de reação Q5 (NEB # B9027) fornece amplificação confiável e robusta. Para amplicons com alto conteúdo de GC (& gt65% GC), a adição do Q5 High GC Enhancer garante um desempenho máximo contínuo. As polimerases de DNA Hot Start Q5 e Q5 estão disponíveis como enzimas autônomas ou em formato de master mix para maior comodidade. As formulações de master mix incluem dNTPs, Mg ++ e todos os componentes tampão necessários.

Amplificação robusta com polimerases de DNA de alta fidelidade Q5 (A) e Q5 Hot Start (B)

Amplificação de uma variedade de amplicons genômicos humanos de baixo a alto teor de GC usando polimerase de DNA de alta fidelidade Q5 ou Q5 Hot Start. As reações usando Q5 Hot Start foram estabelecidas à temperatura ambiente. Todas as reações foram conduzidas usando 30 ciclos de amplificação e visualizadas por análise microfluídica LabChip & reg.

Em contraste com as polimerases hot start quimicamente modificadas ou baseadas em anticorpos, o Hot Start Q5 do NEB (NEB # M0493) utiliza um aptâmero sintético exclusivo. Esta molécula se liga à polimerase por meio de interações não covalentes, bloqueando a atividade durante a configuração da reação. A polimerase é ativada durante as condições normais de ciclo, permitindo que as reações sejam configuradas à temperatura ambiente. O Hot Start Q5 não requer uma etapa separada de ativação de alta temperatura, reduzindo os tempos de reação e aumentando a facilidade de uso. A polimerase Q5 Hot Start é a escolha ideal para amplificação de alta especificidade e fornece amplificação robusta de uma ampla variedade de amplicons, independentemente do conteúdo de GC.

Desempenho de amplificação em uma ampla gama de alvos genômicos

A PCR foi realizada com uma variedade de amplicons, com conteúdo de GC variando de alto AT a alto GC, com Q5 e várias outras polimerases disponíveis comercialmente. Todas as polimerases foram recicladas de acordo com as recomendações do fabricante, incluindo o uso de GC Buffers e realçadores quando recomendado. O rendimento e a pureza dos produtos da reação foram quantificados e representados, como mostrado na chave da figura, pela cor do ponto e tamanho. Um grande ponto verde escuro representa o desempenho de maior sucesso. Q5 oferece desempenho superior em toda a gama de conteúdo de GC.

Os formatos Master Mix e Stand-Alone oferecem conveniência e flexibilidade

Q5 & reg é uma marca registrada da New England Biolabs, Inc.
LabChip & reg é uma marca registrada da Caliper Life Sciences, parte da Perkin Elmer, Inc.

Escolha o tipo:

  • FAQs
  • Protocolos
  • Notas de aplicação
  • Ferramentas e recursos
  • Publicações
  • Ferramenta de Seleção PCR
  • Comparação de polimerases de alta fidelidade
  • Q5 DNA Polymerase oferece amplificação superior para uma ampla gama de modelos
  • Cinco recursos de qualidade do Q5
  • Gráfico de Seleção de DNA Polimerase
  • Informação legal

Artigos de destaque

Leia sobre a relação entre a estrutura e a função da Polimerase ao copiar o DNA.

Brochuras

Ferramentas de Seleção

Guias de solução de problemas

Diretrizes de uso

  1. Fidelidade & ndash a maior amplificação de fidelidade disponível (& gt100X superior a Taq)
  2. Robustez & ndash alta especificidade e rendimento com otimização mínima
  3. Cobertura & ndash desempenho superior para uma ampla gama de amplicons (de alto AT a alto GC)
  4. Velocidade & ndash curtos tempos de extensão
  5. Comprimento do amplicon & ndash amplificações robustas de até 20 kb para modelos simples e 10 kb para complexos

NEB oferece diretrizes para a escolha da DNA polimerase correta para sua aplicação, fornecendo uma lista de propriedades específicas. Vários fatores governam qual polimerase deve ser usada em uma determinada aplicação, incluindo:

Especificidade do modelo / produto: O RNA ou o DNA estão envolvidos? O terminal 3´ está em um gap, nick ou no final do template?

Remoção de nucleotídeos existentes: Os nucleotídeos serão removidos da cadeia polinucleotídica existente como parte do protocolo? Em caso afirmativo, eles serão removidos da extremidade 5´ ou 3´?

Estabilidade térmica: A polimerase precisa sobreviver à incubação em alta temperatura ou a inativação por calor é desejável?

Fidelidade: A análise ou expressão da sequência subsequente dependerá da fidelidade dos produtos sintetizados?

Este produto está coberto por uma ou mais patentes, marcas comerciais e / ou direitos autorais pertencentes ou controlados pela New England Biolabs, Inc (NEB).

Embora a NEB desenvolva e valide seus produtos para várias aplicações, o uso deste produto pode exigir que o comprador obtenha direitos de propriedade intelectual de terceiros para certas aplicações.

Para obter mais informações sobre direitos comerciais, entre em contato com a equipe de Desenvolvimento de Negócios Globais do NEB em [email protected]

Este produto destina-se apenas a fins de pesquisa. Este produto não se destina a ser usado para fins terapêuticos ou de diagnóstico em humanos ou animais.


O que está planejado

- adicionará suporte a cookies para lembrar parâmetros de entrada atribuídos individualmente de uma sessão para a próxima. Se você usar um conjunto padrão de parâmetros, não precisará mais inseri-los novamente cada vez que visitar o servidor muPlex. O uso de cookies é totalmente opcional. Se os cookies estiverem desativados em seu navegador, a interface reverterá silenciosamente para seus parâmetros padrão.

- apresentará um fórum muPlex (wiki?) para fornecer suporte para nossa lista crescente de usuários!

- Você tem ideias para melhorar o muPlex? Nossos esforços de desenvolvimento contínuo são principalmente em resposta às sugestões feitas por nossos usuários. (Ver Perguntas e feedback abaixo.)


Controvérsia sobre a vacina contra HPV

Durante um debate entre os candidatos presidenciais republicanos em 2011, Michele Bachmann, uma das candidatas, deu a entender que a vacina contra o HPV não é segura para crianças e pode causar retardo mental. Cientistas e outros profissionais de saúde imediatamente produziram evidências para refutar essa afirmação. UMA EUA hoje o artigo, & # 8220No Evidence HPV Vaccines Are Dangerous ”(19 de setembro de 2011), descreveu dois estudos dos Centros de Controle e Prevenção de Doenças (CDC) que rastreiam a segurança da vacina. Aqui está um trecho do artigo:

  • Primeiro, o CDC monitora os relatórios para o Sistema de Notificação de Eventos Adversos de Vacinas, um banco de dados para o qual qualquer pessoa pode relatar uma suspeita de efeito colateral. Funcionários do CDC então investigam para ver se os problemas relatados podem ser causados ​​por vacinas ou simplesmente uma coincidência. Em segundo lugar, o CDC tem seguido as meninas que recebem a vacina ao longo do tempo, comparando-as com um grupo de controle de meninas não vacinadas & # 8230. Mais uma vez, a vacina contra o HPV foi considerada segura.

De acordo com um artigo de Elizabeth Rosenthal, "Drug Makers’ Push Leads to Cancer Vaccines ’Rise" (New York Times, 19 de agosto de 2008), o FDA e o CDC disseram que “com milhões de vacinações, por acaso, alguns efeitos adversos graves e mortes ocorrerão no período de tempo após a vacinação, mas não têm nada a ver com a vacina”. O artigo afirmou que o FDA e o CDC monitoram os dados para determinar se ocorrem efeitos mais sérios do que o esperado apenas pelo acaso.

De acordo com outra fonte, os dados do CDC sugerem que graves problemas de saúde após a vacinação ocorrem a uma taxa de cerca de 3 em 100.000. Esta é uma proporção de 0,00003. Mas esses problemas de saúde são por causa da vacina? A taxa de problemas de saúde semelhantes é diferente para aqueles que não receberam a vacina? Vamos supor que não haja diferenças na taxa de problemas de saúde graves entre os grupos de tratamento e controle. Ou seja, vamos supor que a proporção de problemas de saúde graves em ambos os grupos seja 0,00003.

Suponha que o CDC siga uma amostra aleatória de 100.000 meninas que receberam a vacina e uma amostra aleatória de 200.000 meninas que não receberam a vacina. Com o tempo, eles calculam a proporção em cada grupo que tem problemas graves de saúde.

Pergunta: Quanta diferença nessas proporções de amostra é incomum se a vacina não tem efeito sobre a ocorrência de problemas de saúde graves?

Para responder a essa pergunta, precisamos ver quanta variação podemos esperar em amostras aleatórias se não houver diferença na taxa de ocorrência de problemas graves de saúde, então usamos a distribuição amostral de diferenças nas proporções amostrais.

  • Spread: As grandes amostras irão produzir um erro padrão que é muito pequeno. O erro padrão das diferenças nas proporções da amostra é

Responder: Podemos ver as amostras aleatórias que variam mais de 2 erros padrão da média como incomuns. Se não houver diferença na taxa de ocorrência de problemas graves de saúde, a média é 0. Portanto, as diferenças nas taxas maiores que 0 + 2 (0,00002) = 0,00004 são incomuns. Isso equivale a cerca de mais 4 casos de problemas graves de saúde em 100.000. Com amostras tão grandes, vemos que um pequeno número de casos adicionais de problemas de saúde graves no grupo da vacina parecerá incomum. Mas 4 casos em 100.000 são de significado prático, dados os benefícios potenciais da vacina? Esta é uma questão importante para o CDC abordar.

Tente

De acordo com um estudo de 2008 publicado pela AFL-CIO, 78% dos trabalhadores sindicalizados tinham empregos com cobertura de saúde do empregador, em comparação com 51% dos trabalhadores não sindicalizados. Em 2009, o Employee Benefit Research Institute citou dados de grandes amostras que sugeriam que 80% dos trabalhadores sindicalizados tinham cobertura de saúde em comparação com 56% dos trabalhadores não sindicalizados. Suponhamos que os dados de 2009 tenham vindo de amostras aleatórias de 3.000 trabalhadores sindicalizados e 5.000 trabalhadores não sindicalizados.

Tente

A seguir, um trecho de um comunicado à imprensa no site da AFL-CIO publicado em outubro de 2003.

  • O Wal-Mart exemplifica a tendência prejudicial entre os grandes empregadores da América de se esquivar das responsabilidades do seguro saúde às custas de seus trabalhadores e da comunidade & # 8230. Com cobertura reduzida e aumento dos honorários dos trabalhadores, o Wal-Mart & # 8211, o maior empregador privado dos EUA & # 8211, estabelece um padrão preocupante. Menos da metade dos trabalhadores do Wal-Mart são segurados pelo plano da empresa & # 8211 apenas 46 por cento. Esta taxa é dramaticamente inferior aos 66 por cento dos trabalhadores em grandes empresas privadas que são segurados pelos planos de suas empresas, de acordo com um novo estudo do Commonwealth Fund divulgado hoje que documenta a tendência crescente entre os grandes empregadores de abandonar o seguro saúde para seus trabalhadores.

Suponha que queremos ver se essa diferença reflete a cobertura de seguro para os trabalhadores em nossa comunidade. Selecionamos uma amostra aleatória de 50 funcionários do Wal-Mart e 50 funcionários de outras grandes empresas privadas em nossa comunidade. Suponha que 20 dos funcionários do Wal-Mart e 35 dos outros funcionários tenham seguro por meio de seu empregador.


Perguntas frequentes sobre AmpliSeq para painéis personalizados e da comunidade da Illumina

Não, uma nova versão não está planejada no momento. Os painéis prontos para uso e os painéis comunitários são baseados em hg19. A conversão de painéis pré-projetados pode ser considerada no futuro com base na demanda do mercado.

Estúdio de design

Quais são os tamanhos de amplicon alvo?

O amplicon pode ter um intervalo em que você seleciona o tamanho máximo do amplicon.

Os tamanhos do amplicon são equivalentes aos tamanhos dos insertos?

Como digerimos os primers durante a etapa de digestão parcial dos amplicons, os tamanhos dos insertos resultantes serão menores do que o tamanho do amplicon. Dependendo do comprimento de leitura escolhido, recomendamos o corte do adaptador.

Por que alguns alvos são difíceis de projetar no DesignStudio?
  • Homólogos: Ter homólogos no mesmo projeto pode levar a uma baixa capacidade de design. Divida os homólogos em pools separados.
  • Conteúdo GC: Regiões com conteúdo de GC superior a 80% podem ser difíceis de projetar, especialmente quando essas regiões têm comprimento superior a 500 bp.
  • Sequências de homopolímero e elementos repetitivos: DesignStudio evita essas regiões para garantir que as sondas tenham melhor especificidade no genoma.
  • Especificidade pobre: O DesignStudio avaliará a especificidade das sondas e excluirá aquelas que não fornecerão uma cobertura satisfatória no alvo.
Como o DesignStudio seleciona os primers?

As sondas ideais são escolhidas usando um algoritmo que considera a temperatura de fusão (Tm),% GC, comprimento, estrutura secundária, exclusividade no genoma e a presença de SNPs subjacentes (com base em dbSNP). Para obter mais informações, consulte a ajuda online do DesignStudio.

Como posso melhorar a capacidade de design e a cobertura do meu projeto DesignStudio?
  • Aumentar o tamanho do alvo contra o qual projetar pode resgatar regiões anteriormente "indesejáveis". O tamanho aumentado de um alvo dá ao DesignStudio um pouco mais de flexibilidade para ajustar um amplicon de pontuação mais alta sobre as bases de alvo desejadas.
  • Mude o contexto do painel - por exemplo, colocar uma sequência alvo altamente homóloga ou rica em GC no mesmo projeto multiplex pode ser problemático para projetar sondas para amplificar cada alvo separadamente. Mover regiões problemáticas para um design separado pode freqüentemente melhorar a capacidade de design.
  • Altere os níveis de rigor.
Posso criar um design de piscina dupla?

Não. Este é um PCR multiplex que não será capaz de discernir entre a fita superior e a inferior.

Posso editar o conteúdo do meu design depois de enviá-lo?

Não. No entanto, você pode usar o botão “Modificar design” para copiar o conteúdo para um novo painel e editá-lo.

Posso editar meu design depois de fazer um pedido?

Não. Depois de fazer um pedido, você não pode editar o design. Os arquivos necessários para análise pelo BaseSpace Sequence Hub e Local Run Manager devem permanecer sincronizados com o material que você solicitou.

Qual é o tempo de resposta atual para um projeto enviado em relação ao tamanho ou número de alvos alvo?

Um projeto menor que 250 kb tem um tempo de resposta esperado de 48 horas ou menos. Projetos com mais de 250 kb ou com muitos destinos podem levar mais de 48 horas para retornar.

Projetos sob demanda têm um tempo de resposta mais curto do que outros envios. Projetos sob demanda de 250 kb ou menos devem ser devolvidos em menos de 2 horas.

O que determina os critérios de design do amplicon?

Atualmente, o DesignStudio permite que os usuários escolham um tamanho de amplicon de 140, 175, 275 ou 375 (recomendado para MiSeq) para cada design. O tamanho do amplicon inclui as sequências de iniciador e as regiões de inserção. Recomendamos o uso de 175 pb para DNA FFPE, 140 pb para cfDNA e 275 pb para DNA normal.

É possível usar um design AmpliSeq for Illumina para rastrear muitos SNPs (até 1000 ou mais) para muitos indivíduos (até 1000 ou mais)?

Sim, o DesignStudio permite a genotipagem SNP por sequenciamento.

Qual é o maior projeto que posso enviar ao gasoduto AmpliSeq para Illumina?

Você pode enviar projetos de até 500 kb diretamente para o pipeline. O pipeline é capaz de processamento de projetos de até 5 Mb, mas esses projetos são caros e consomem uma grande quantidade de recursos computacionais.

Recomendamos que você envie projetos de até 2 Mb. Para designs entre 2 Mb e 5 Mb, recomendamos que você entre em contato com seu especialista de vendas.

Quais painéis posso usar para adicionar amplicons a um novo design?

Você pode copiar amplicons de painéis AmpliSeq for Illumina personalizados, comunitários e fixos usando as mesmas espécies do seu projeto. Para obter informações sobre a comunidade disponível e os painéis fixos, entre em contato com o suporte técnico da Illumina.

DesignStudio - Primer Bioinformatics

Qual é o nível de sobreposição entre os primers?

Os primers na mesma piscina / tubo não se sobrepõem.

Com AmpliSeq para projetos Illumina no DesignStudio, os conjuntos de primer são projetados automaticamente (com um programa de computador), sem interrogatório de um cientista pesquisador?

O processo é um pipeline automatizado, otimizado para fornecer a cobertura máxima com conjuntos de primer confiáveis.

DesignStudio - Pedido de Oligo

Posso adicionar mais alguns genes a um conjunto de primers previamente ordenados?

Não. Você deve modificar o design, adicionar os novos genes e enviar um novo pedido.

Se eu tiver primers regulares para uma região e souber que estão funcionando, posso adicioná-los ao design do AmpliSeq para Illumina?
Posso adicionar primers manualmente, pós-design, para cobrir uma região completamente?

Não. Usamos primers especialmente modificados, portanto primers padrão não permitem a construção de bibliotecas.

Há um pedido mínimo de AmpliSeq para designs Illumina Gene e Hotspot?

Os painéis personalizados AmpliSeq for Illumina variam de 12 amplicons a 3.072 amplicons por pool. As regiões de destino podem ser tão pequenas quanto 1 bp, mas como os designs devem incluir 12 amplicons, você precisaria de 12 conjuntos de regiões de 1 bp.

Todos os pedidos têm um preço mínimo equivalente ao custo de um pedido contendo 48 amplicons.

Em que formato de contêiner devo esperar receber meus primers personalizados?

Cada pool de primer personalizado é fornecido como um tubo pré-pool.

Como posso saber o status do envio de um projeto para o AmpliSeq for Illumina Custom Panel?

Email [email protected] Use o seu AmpliSeq para o número de ID do projeto Illumina ou o número de ID da solução ao se referir ao seu pedido.

DesignStudio - Solução de problemas e validação

Suponha que eu esteja visando uma região e o DesignStudio sugira um projeto que consiste em dois pools de primer. Para cada amostra, devo preparar uma biblioteca para cada amplificação (cada pool)? Ou devo combinar as duas amplificações (os produtos dos dois pools amplificados) e, em seguida, preparar a biblioteca?

Se o seu projeto resultar em vários pools, cada pool será processado independentemente por meio de “Amplify DNA / cDNA Targets”, conforme referido no Guia de referência do painel personalizado e comunitário AmpliSeq for Illumina. As piscinas são então combinadas antes da etapa “Amplicons parcialmente digeridos”. Eles continuam como uma amostra através da ligação de índice e amplificação final da biblioteca.

Quantos pares de bases separam os primers da região alvo?

Para garantir que um exon inteiro seja coberto, por padrão, adicionamos 25 bp de preenchimento para cima e para baixo da região de destino selecionada. Este enchimento permite espaço para colocar os primers. O preenchimento garante o sequenciamento de alta qualidade nas extremidades dos exons e permite algum sequenciamento nas regiões de junção de emenda. As regiões do primer não são consideradas cobertas. Portanto, se a cobertura obtida do projeto inicial for inferior a 100%, podemos tentar mais uma vez estender o primer ainda mais no íntron para capturar todo o exon.

Entrada

Qual quantidade de entrada de DNA é necessária?

O ensaio usa entre 1 e 100 ng de DNA por pool de primer, com a maioria dos projetos usando 10 ng por pool.

Que qualidade de DNA é necessária e como a qualidade do DNA deve ser avaliada?

Vimos sucesso com entradas de baixa qualidade usando as modificações de protocolo indicadas nos guias do usuário. Os métodos de extração de DNA comercialmente disponíveis ou validados por laboratório geralmente produzem DNA que é compatível com este ensaio. A pureza do DNA deve ter uma proporção A260 / A280 de 1,8–2,0. PicoGreen é recomendado para uma quantificação precisa.

As amostras FFPE são suportadas?

Use apenas DNA derivado de FFPE ao usar comprimentos de amplicon curtos de 140 ou 175 bp. Os amplicons mais curtos fornecem uma amplificação melhor do que os mais longos quando a amostra de entrada é DNA derivado de FFPE fragmentado.

Quanto DNA pode ser direcionado com este kit?

Há um limite de 12-6.144 pares de primers por pool. Se estiver gerando região alvo maior que 5Mb, recomendamos selecionar uma opção de enriquecimento.

Protocolo

Este ensaio usa os adaptadores padrão Nextera ou TruSeq?

Os adaptadores usados ​​neste ensaio são otimizados para o fluxo de trabalho AmpliSeq. Os adaptadores Nextera ou TruSeq não são compatíveis com este ensaio.

O que é necessário para comprar na Illumina?
Posso realizar duas ou três amplificações diferentes e agrupá-las antes de entrar na preparação da biblioteca?

É possível executar 3 designs AmpliSeq for Illumina diferentes, cada um com códigos de barras na mesma execução de sequenciamento. No entanto, o tamanho do amplicon desejado e a cobertura necessária devem ser alcançados em uma única execução.

Sequenciamento

Qual comprimento de leitura é recomendado para sequenciamento?

Uma leitura de extremidade emparelhada de 2 × 150 bp é recomendada para tamanhos de amplicon de 140-275 bp. A execução de extremidades emparelhadas de até 2x300 bp no MiSeq é recomendada para tamanhos de amplicon de 375 bp.

Quantas amostras podem ser sequenciadas por vez?

Este kit possui códigos de barras de amostra integrados que permitem o agrupamento de até 96 amostras por execução de sequenciamento. No entanto, o número real de amostras que podem ser agrupadas por execução de sequenciamento depende do número de amplicons e da profundidade desejada de cobertura de sequenciamento. Uma calculadora online é fornecida no DesignStudio para ajudar com esses cálculos.

Análise

Quais ferramentas são oferecidas para análise de dados?

O Local Run Manager e o BaseSpace Sequence Hub têm aplicativos disponíveis para análise. O aplicativo DNA Amplicon Analysis e o aplicativo RNA Amplicon Analysis estão disponíveis no BaseSpace Sequence Hub. Uma análise posterior pode ser realizada em qualquer chamada de variante usando o BaseSpace Variant Interpreter. O Local Run Manager tem um Módulo de Análise de Amplicon de DNA e um Módulo de Análise de Amplicon de RNA semelhantes que utilizam o mesmo fluxo de trabalho e algoritmo que os Aplicativos de Hub de Sequência BaseSpace.

O fluxo de trabalho de análise de DNA Amplicon pode ser usado para realizar alinhamento e chamada de variantes e o fluxo de trabalho de análise de RNA Amplicon para chamada de fusão. Além disso, para o chamador OncoCNV, um BaseSpace Lab Apps está disponível para análise de CNV.

Posso visualizar dados de amostra?

Sim, existem conjuntos de dados de exemplo em Dados Públicos do BaseSpace.

Que desempenho real do ensaio posso esperar do meu projeto?

O DesignStudio retorna designs de amplicon de alta confiança que proporcionaram desempenho de multiplexação de amplicon sem precedentes. Uma vez que cada projeto é único e a entrada da amostra pode variar, o desempenho do projeto precisará ser testado empiricamente.

Are there non-encrypted manifest files available for my RNA panels (custom or fixed) containing fusions?

No. Manifest files for any RNA panel containing fusions are unavailable in a non-encrypted format. Only the encrypted manifest file is available.

Where can I find the breakpoint details for fusion panels (custom or fixed) included in the design?

Information about exact breakpoints contained in all RNA fusion panel designs is not provided. The result files produced by Illumina software analysis tools provide details of any RNA fusion events identified by the software. For information on which gene pairs are evaluated for your panel, see the panel's data sheet.

Where can I find my alignment files (eg, BAM files) from my analysis of RNA panels containing fusions?

Illumina software packages, including BaseSpace Sequence Hub Apps, do not provide alignment files as output from the analysis. At this time, only the final reporting of the results from the analysis are provided. For more details, consult the software's documentation.

Is there any information about potential false negatives or uncalled fusions from analysis of RNA panels containing fusions?

No. The software only reports detected fusion events. For information on which gene pairs are evaluated for your panel, see the panel's data sheet.

AmpliSeq for Illumina On-Demand

What is the minimum number of genes I can order in an On-Demand panel?

We’ve set an ordering minimum of 1 gene or 24 amplicons per panel. Designs must also have at least 2 pools and 12 amplicons per pool.

What is the maximum number of genes I can order in an On-Demand panel?

We have set an ordering maximum of 500 genes or 15,000 amplicons per panel due to manufacturing restrictions. We are always making improvements, so this limit is likely to increase. You may be able to order larger designs in the future.

What annotation source and version is used to recognize gene symbols when creating an On-Demand Panel?

Illumina uses RefGene v74 as the source of annotations.

Are untranslated regions (UTRs) included in an On-Demand gene’s design?

No, only the coding DNA sequence (CDS) region of a gene is included as part of an On-Demand gene design.

What is “Gene Amplicon Uniformity”?

Gene amplicon uniformity is the percentage of amplicons for a gene with greater than 0.2 times the mean coverage of all amplicons targeting that gene. It represents the observed wet-lab uniformity calculated from NextSeq data with the Illumina DNA Amplicon workflow.

Do On-Demand panels support UTR-only genes? What about pseudogenes?

No. On-Demand panels only support genes containing CDS regions. Pseudogenes are not supported.

What is the padding used for On-Demand gene designs?

The padding for every On-Demand gene design is 5 bp on the 5′ and 3′ ends of the exon.

Have all possible gene combinations been tested for primer-primer interactions?

No. The number of possible combinations is astronomical. It is not feasible to test for all possible combinations in the lab. However, through computer-based searches, we have reduced the occurrence of primer-primer interactions as much as possible. In addition, when synthesizing many genes simultaneously in large batches, we have observed less than 1% amplicon drop-out due to suspected primer-primer interactions.

Why are the number of primer pairs per pool indicated on the tube and box labels different than the number of amplicons per pool indicated in DesignStudio?

O número de amplicons per pool in DesignStudio reflects the number of unique amplicons in each pool. O número de primer pairs per pool on the tube and box labels reflects the total number of oligos per pool. Either value can be used when preparing libraries according to the AmpliSeq for Illumina On-Demand, Custom and Community Panels Reference Guide (Table 4. X cycles and X minutes). If the values fall into different cycle categories, the higher PCR cycle number is recommended.

AmpliSeq for Illumina On-Demand – IGV Viewer

What is the “observed coverage” track in the IGV viewer?

The “observed coverage” track indicates the number of observed reads for each amplicon of each targeted gene during validation experiments on a NextSeq. Use this track as general guidance for the likely performance when running an experiment. While values can vary among assays, the general coverage trend should remain consistent.

What are “Gaps”?

Gaps occur where there are no amplicons to provide coverage for the intended target. We have made every effort to minimize the occurrence of these regions in our On-Demand designs.

What is the scale on the Y-axis?

The Y-axis represents the observed coverage normalized by the mean amplicon coverage for the gene.

Can I use coordinates to navigate the IGV viewer?

No. The IGV viewer can only focus on your gene of interest. In the Grid View, select a gene, and the IGV viewer updates automatically to center on that gene.

I notice that the “observed coverage” track for an amplicon occasionally does not appear to contain information. Por que é que?

All amplicons in the design contain reads that are visualized in the “observed coverage” track. If the number of reads covering an amplicon is relatively small in comparison to neighboring amplicons, the “observed coverage” track appears empty. However, if you change the scale to a lower value, you will then be able to visualize the lower number of reads. If the observed coverage track is not present, the designer notifies you why that track is not available.

Entre em contato conosco
Technical Support
Share With Tech Support

Get instructions for sharing your desktop while working with Technical Support.

Other Support
Entre em contato conosco
Technical Support
[email protected]
Other Support

Innovative technologies

At Illumina, our goal is to apply innovative technologies to the analysis of genetic variation and function, making studies possible that were not even imaginable just a few years ago. It is mission critical for us to deliver innovative, flexible, and scalable solutions to meet the needs of our customers. As a global company that places high value on collaborative interactions, rapid delivery of solutions, and providing the highest level of quality, we strive to meet this challenge. Illumina innovative sequencing and array technologies are fueling groundbreaking advancements in life science research, translational and consumer genomics, and molecular diagnostics.

Apenas para uso em pesquisa. Não deve ser usado em procedimentos de diagnóstico (exceto quando especificamente indicado).


COVER: a priori estimation of coverage for metagenomic sequencing

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Resumo

In any metagenomic project, the coverage obtained for each particular species depends on its abundance. This makes it difficult to determine a priori the amount of DNA sequencing necessary to obtain a high coverage for the dominant genomes in an environment. To aid the design of metagenomic sequencing projects, we have developed COVER, a web-based tool that allows the estimation of the coverage achieved for each species in an environmental sample. COVER uses a set of 16S rRNA sequences to produce an estimate of the number of operational taxonomic units (OTUs) in the sample, provides a taxonomic assignment for them, estimates their genome sizes and, most critically, corrects for the number of unobserved OTUs. COVER then calculates the amount of sequencing needed to achieve a given goal. Our tests and simulations indicate that the results obtained through COVER are in very good agreement with the experimental results.

Fig. S1. The accuracy of the estimation of the fraction of 16S rRNA sequences belonging to unobserved OTUs (Good&aposs sample coverage). The results were obtained using a simulated data set composed of 16S rRNA sequences corresponding to 200 genomes, with abundances following a log-normal distribution (upper panel) or a broken-stick distribution (lower panel). Both distributions are used in ecology: the first is widely found in many natural communities, whereas the second is predicted for communities where the resources are partitioned into niches at random. Although microbial communities usually do not follow the broken-stick distribution, we wanted to test the performance of our calculation under this model of extremely high evenness. The insets show a rank-abundance graph showing the shapes of the respective distributions, with species ranked by abundance on the x-axis. The expected number of sequences is calculated using Good&aposs estimator, as described in the main text, whereas the real numbers are obtained by the random sampling of the number of sequences indicated by the x-axis.

Fig. S2. Accuracy of the estimation of unknown genome sizes. Upper: The difference in the genome size (expressed as |S1 − S2/max(S1, S2)|, with S1 and S2 representing the real sizes of the genomes) for pairs of genomes of known sizes, in relation to their taxonomic proximity. The relationship between the genome size and taxonomic relatedness is apparent. For instance, genomes related at the species level (i.e. different strains from the same species) usually have less than a 10% difference in genome size. If the genomes belong to the same genus, the difference can extend to 25%, although in most cases, it remains at 10% or less. Lower: Use of the genome sizes of sequenced species to infer the sizes for species currently being sequenced (species ‘in progress’ in the NCBI database, http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi, whose size has been estimated, usually via PFGE). The plot shows the probability of inferring the size correctly using the sizes of other species at different taxonomic ranks. For instance, the case marked by a dashed line in the plot corresponds to the estimation of the size of some species using the known sizes of other species from the same genus. In that case, there is an approximate 75% probability that we can infer its genome size with less than 10% error.

Fig. S3. Accuracy of the estimation of the 16S rRNA copy number. Differences in copy number (expressed as |C1 − C2/max(C1, C2)|, with C1 and C2 representing the numbers of 16S copies in the genomes) for pairs of genomes of known copy number, in relation to their taxonomic proximity.

Fig. S4. Variation of the estimated coverage in relation to the number of 16S rRNA sequences provided. A community of 100 species was simulated, and the estimated coverage for the first 10 members was calculated by COVER using different initial numbers of 16S sequences, supposing a sequencing effort of 500 000 reads of 400 base pairs each. It can be seen that the estimates of coverage oscillate greatly when few sequences are provided, indicating that the community composition is still not well determined. When a substantial amount of 16S sequences is provided (between 2000 and 3000, in this case), the estimated coverage values stabilize and are very similar to the real coverage values (last point in the plot).

Fig. S5. Results of the estimation of coverage for a controlled data set composed of 100 genomes, with abundances following a log-normal distribution. The results are obtained by simulating the sequencing of 500 000 reads of 400 bp each. The plot shows the real coverage for each species (red line) and the obtained coverage predicted by COVER (green points). Species (genomes) are sorted according their abundances. Estimated coverage values match the real values very well. Some instances have no coverage estimated. These species have been merged with closely related ones because the 16S identity for the related species is 98% or more. Por exemplo, Burkholderia cenocepacia is given a coverage of zero because it was merged with Burkholderia pseudomallei, whose coverage is, thus, overestimated. Both species share 98% identity in their 16S rRNA. There was a similar occurrence for two more cases in this experiment: Bacillus anthracis was merged with Bacillus cereus, e Escherichia fergusonii was merged with Escherichia coli.

Table S1. Upper: Number of taxa for each rank, as listed in NCBI&aposs taxonomy database (http://www.ncbi.nlm.nih.gov/Taxonomy) and the number of taxa containing at least one member with known size (from either complete genomes, genomes in progress or genomes with PFGE size estimates, http://www.genomesize.com/prokaryotes). Lower: Presence of families without any members of known genome size in the environmental samples (http://metagenomics.uv.es/envDB). In a set of 3035 samples, 810 contain a member from one of these families.

Table S2. Results obtained for the estimation of the number of reads needed for obtaining coverage 5× for the most represented genome in a controlled data set composed of 300 genomes, with abundances following a log-normal distribution. For studying the influence of inaccurate estimations of genomic sizes, we allowed these sizes to vary by some percentage of their original values. We draw a random value between 0 and a given percentage of the estimated genomic size, and added or subtracted that value to the estimation. The results obtained allowing 20% and 50% of variation are shown. The values change around 10% when allowing 20% of variation in the estimated sizes, and barely 25% when allowing 50% of variation.

Tabela S3. Comparison of the real and expected results for two metagenomic sequencing projects. The metagenomes were kindly provided by Dr Alejandro Mira (CSISP, Valencia, Spain), and they consist of two coupled sets of 16S and metagenomic sequences from oral samples. The first was obtained by sequencing amplicons from clone libraries. The contig length distributions for the real and expected instances were calculated as described in the text.

Nome do arquivo Descrição
EMI4_338_sm_FigS1.jpg165 KB Item de informação de apoio
EMI4_338_sm_FigS2.jpg207.5 KB Item de informação de apoio
EMI4_338_sm_FigS3.jpg61.4 KB Item de informação de apoio
EMI4_338_sm_FigS4.jpg93.6 KB Item de informação de apoio
EMI4_338_sm_FigS5.jpg46.1 KB Item de informação de apoio
EMI4_338_sm_TabS1.doc23 KB Item de informação de apoio
EMI4_338_sm_TabS2.doc27.5 KB Item de informação de apoio
EMI4_338_sm_TabS3.doc33.5 KB Item de informação de apoio

Observação: O editor não é responsável pelo conteúdo ou funcionalidade de qualquer informação de suporte fornecida pelos autores. Quaisquer dúvidas (que não sejam de conteúdo ausente) devem ser direcionadas ao autor correspondente do artigo.


Assista o vídeo: O que faz um BIOINFORMATA? - A CARREIRA em Bioinformática (Agosto 2022).